RegulonDB RegulonDB 11.2: Operon Form
   

ompC operon and associated TUs in Escherichia coli K-12 genome




Operon      
Name: ompC
This page displays every known transcription unit of this operon and their known regulation.


Transcription unit          
Name: ompC
Synonym(s): OP00065
Gene(s): ompC   Genome Browser M3D Gene expression COLOMBOS
Note(s): The ompC gene, which codes for one membrane porin, is positively regulated by EvgA (transcriptional activator of the EvgS/EvgA two-component system) Utsumi R, Katayama S, Taniguchi M, Horie T, Ikeda M, Igaki S, Nakagawa H, Miwa A, Tanabe H, Noda M,1994. Utsumi R, Katayama S, Ikeda M, Igaki S, Nakagawa H, Miwa A, Taniguchi M, Noda M,1992 CpxR, and OmpR and negatively regulated by Lrp.
The negative effect of Lrp, which is insensitive to leucine Ferrario M,1995 is shared with the divergent gene micF (an antisense RNA), as it binds at several sites along the intergenic and micF regions in an additive manner (the binding of one protein favors the binding of the others) Ferrario M,1995
It was proved in an experiment with increasing concentrations of the antibiotic tetracycline that ompC gene expression is induced in low concentrations (1.5 and 4 mg/L), but not in high ones (10 mg/L); this suggests that the product of this gene plays a role under this condition Viveiros M, Dupont M, Rodrigues L, Couto I, Davin-Regli A, Martins M, Pagès JM, Amaral L,2007
ompC is upregulated and downregulated in response to nalidixic acid (NA) and chlortetracycline (CTC), respectively, in parallel and in the opposite direction with atpB gene Lin X,2012 these changes are regulated by CpxR Lin X,2012
The expression of the gene ompC is increased under acidic growth conditions in either aerobiosis or microaerobiosis Marzan LW,2013 The increased expression under aerobiosis appears to be caused by the transcription factor PhoB Marzan LW,2013 but it is not known which promoter, of three transcribing ompC, is affected by PhoB.
Evidence: [EXP-IDA-TRANSCRIPT-LEN-DETERMINATION] Length of transcript experimentally determined
Reference(s): [1] Huang L., et al., 1990
[2] Mizuno T., et al., 1983
Promoter
Name: ompCp1
+1: 2312830
Sigma Factor: Sigma70 Sigmulon
Distance from start of the gene: 81
Sequence: cttaaaagttttagtatcatattcgtgttggattattctgcatttttggggagaatggacTtgccgactgattaatgaggg
                                 -35                    -10 +1                   
Note(s): OmpR transcriptional factor cooperatively binds to the sites of the upstream regions from the ompCp1 promoter in a discontinuous galloping manner, as described by Yoshida T,2006
Evidence: [COMP-AINF]
[EXP-IDA-HPT-TRANSCR-INIT-M-RACE-MAP]
[EXP-IDA-TRANSCRIPTION-INIT-MAPPING]
Reference(s): [1] Huang L., et al., 1990
[3] Huerta AM., et al., 2003
[4] Mendoza-Vargas A., et al., 2009
Terminator(s)
Type: rho-independent
Sequence: caatgaaaaaAGGGCCCGCAGGCCCtttgttcgat
Reference(s): [2] Mizuno T., et al., 1983
TF binding sites (TFBSs)
[CpxR,+] Phrase
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence Confidence level (C: Confirmed, S: Strong, W: Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
remote CpxR-phosphorylated activator ompCp1 2312920 2312931 -95.0 aagttcccttGCATTTACATTTtgaaacatct nd [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [COMP-AINF-SIMILAR-TO-CONSENSUS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS] W [11]
remote CpxR-phosphorylated activator ompCp1 2312963 2312964 -134.0 gtgcttatttCgccattccgc nd [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [COMP-AINF-SIMILAR-TO-CONSENSUS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS] W [11]
remote CpxR-phosphorylated activator ompCp1 2313180 2313181 -351.0 tgtgtaaagaAgggtaaaaaa nd [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [COMP-AINF-SIMILAR-TO-CONSENSUS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS] W [11]
[EnvY,+] Phrase
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence Confidence level (C: Confirmed, S: Strong, W: Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
nd EnvY activator ompCp1 nd nd nd nd nd [EXP-IMP] W [22]
[IHF,-] Phrase
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence Confidence level (C: Confirmed, S: Strong, W: Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
remote IHF repressor ompCp1 2313006 2313018 -182.0 tacttaagaaTAAGTTATTGATTttaaccttga nd [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [COMP-HINF-SIMILAR-TO-CONSENSUS], [EXP-IDA-BINDING-OF-CELLULAR-EXTRACTS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS] C nd
[Lrp,-] Phrase
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence Confidence level (C: Confirmed, S: Strong, W: Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
remote Lrp repressor ompCp1 2312738 2312752 86.0 gagggttaatAACATGAAAGTTAAAgtactgtccc nd [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS] W [9], [10]
remote Lrp-L-leucine repressor ompCp1 2312761 2312772 64.5 gcaaataaagGCATATAACAGAgggttaataa nd [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS] W [9], [10]
proximal Lrp repressor ompCp1 2312822 2312836 2.0 tttggggagaATGGACTTGCCGACTgattaatgag nd [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS] W [9], [10]
proximal Lrp repressor ompCp1 2312852 2312866 -29.5 tatcatattcGTGTTGGATTATTCTgcatttttgg nd [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [COMP-AINF-SIMILAR-TO-CONSENSUS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS] W [9], [10], [21]
remote Lrp repressor ompCp1 2313103 2313117 -280.5 ttcagaaatgAATGACGGTAATAAAtaaagttaat nd [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS] W [9], [10]
remote Lrp repressor ompCp1 2313134 2313148 -311.5 ggcatccggtTGAAATAGGGGTAAAcagacattca nd [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS] W [9], [10]
remote Lrp repressor ompCp1 2313163 2313177 -340.5 taaagaagggTAAAAAAAACCGAATgcgaggcatc nd [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS] W [9], [10]
remote Lrp repressor ompCp1 2313199 2313213 -376.0 gtttttctgtGGTAGCACAGAATAAtgaaaagtgt nd [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS] W [9], [10]
[OmpR,+] Phrase
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence Confidence level (C: Confirmed, S: Strong, W: Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
proximal OmpR-phosphorylated activator ompCp1 2312868 2312887 -47.5 gaaacatcttAAAAGTTTTAGTATCATATTcgtgttggat nd [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [COMP-HINF-SIMILAR-TO-CONSENSUS], [EXP-CHIP-SEQ], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS], [EXP-IMP-SITE-MUTATION] C [12], [14], [15], [16], [18], [20]
proximal OmpR-phosphorylated activator ompCp1 2312888 2312907 -67.5 aaacatctatAGCGATAAATGAAACATCTTaaaagtttta nd [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [COMP-HINF-SIMILAR-TO-CONSENSUS], [EXP-CHIP-SEQ], [EXP-DAP-SEQ], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS], [EXP-IMP-SITE-MUTATION] C [12], [14], [15], [16], [17], [18]
proximal OmpR-phosphorylated activator ompCp1 2312909 2312928 -88.5 ttcccttgcaTTTACATTTTGAAACATCTAtagcgataaa nd [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [COMP-HINF-SIMILAR-TO-CONSENSUS], [EXP-CHIP-SEQ], [EXP-DAP-SEQ], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS], [EXP-IMP-SITE-MUTATION] C [12], [13], [14], [15], [16], [17], [18]
[YjjQ,-] Phrase
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence Confidence level (C: Confirmed, S: Strong, W: Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
proximal YjjQ repressor ompCp1 2312887 2312901 -64.0 ctatagcgatAAATGAAACATCTTAaaagttttag nd [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [COMP-AINF-SIMILAR-TO-CONSENSUS] W [19]
sRNA Interaction TU
sRNA TU Regulated Function Binding Sites Regulatory Mechanism Evidence (Confirmed, Strong, Weak) Reference(s)
PosLeft PosRight Target sequence (mRNA)
small regulatory RNA RybB ompC repressor 2312750 2312782 GUUAUUAACCCUCUGUUAUAUGCCUUUAUUUGC nd [AS-HYPO], [EXP-IEP], [EXP-IPI] [5], [6]
small regulatory RNA MicC ompC repressor 2312764 2312790 GUUAUAUGCCUUUAUUUGCUUUUUUAU TRANSLATION-BLOCKING [EXP-IEP], [EXP-IMP-SITE-MUTATION] [7]
small regulatory RNA RseX ompC repressor 2312750 2312780 GUUAUUAACCCUCUGUUAUAUGCCUUUAUUU MRNA-DEGRADATION [EXP-IEP] [8]


Transcription unit          
Name: ompC
Gene(s): ompC   Genome Browser M3D Gene expression COLOMBOS
Note(s): EvgA, the transcriptional activator of the two-component regulatory system EvgS/EvgA, positively regulates the transcription of the ompC gene, which codes for an outer membrane porin Utsumi R, Katayama S, Taniguchi M, Horie T, Ikeda M, Igaki S, Nakagawa H, Miwa A, Tanabe H, Noda M,1994. Utsumi R, Katayama S, Ikeda M, Igaki S, Nakagawa H, Miwa A, Taniguchi M, Noda M,1992
It was proved in an experiment with increasing concentrations of the antibiotic tetracycline that the ompC gene is induced in low concentrations (1.5 and 4 mg/L), but not in high ones (10 mg/L); this suggests that the product of this gene plays a role under this condition Viveiros M, Dupont M, Rodrigues L, Couto I, Davin-Regli A, Martins M, Pagès JM, Amaral L,2007
Binding of Lrp to one site enhances occupancy of the other sites for Lrp in the ompCp2 promoter. Leucine does not abolish DNA binding by the ligated Lrp but it may alter the affinity of Lrp for specific sites on DNA.
The expression of the gene ompC is increased under acidic growth conditions in either aerobiosis or microaerobiosis Marzan LW,2013 The increased expression under aerobiosis appears to be caused by the transcription factor PhoB Marzan LW,2013 but it is not known which promoter, of three transcribing ompC, is affected by PhoB.
Evidence: [EXP-IDA-TRANSCRIPT-LEN-DETERMINATION] Length of transcript experimentally determined
Reference(s): [1] Huang L., et al., 1990
Promoter
Name: ompCp2
+1: 2312864
Distance from start of the gene: 115
Sequence: cattttgaaacatctatagcgataaatgaaacatcttaaaagttttagtatcatattcgtGttggattattctgcattttt
Evidence: [EXP-IDA-TRANSCRIPTION-INIT-MAPPING]
Reference(s): [1] Huang L., et al., 1990
Terminator(s)
Type: rho-independent
Sequence: caatgaaaaaAGGGCCCGCAGGCCCtttgttcgat
Reference(s): [2] Mizuno T., et al., 1983
TF binding sites (TFBSs)
[Lrp,-] Phrase
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence Confidence level (C: Confirmed, S: Strong, W: Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
remote Lrp repressor ompCp2 2312738 2312752 120.0 gagggttaatAACATGAAAGTTAAAgtactgtccc nd [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS] W [9], [10]
remote Lrp repressor ompCp2 2312759 2312773 98.5 agcaaataaaGGCATATAACAGAGGgttaataaca nd [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS] W [9], [10]
remote Lrp repressor ompCp2 2312822 2312836 36.0 tttggggagaATGGACTTGCCGACTgattaatgag nd [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS] W [9], [10]
proximal Lrp repressor ompCp2 2312852 2312866 5.5 tatcatattcGTGTTGGATTATTCTgcatttttgg nd [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [COMP-AINF-SIMILAR-TO-CONSENSUS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS] W [9], [10], [21]
remote Lrp repressor ompCp2 2313031 2313045 -174.0 tttgttttgaCATTCAGTGCTGTCAaatacttaag nd [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS] W [9], [10]
remote Lrp repressor ompCp2 2313103 2313117 -246.5 ttcagaaatgAATGACGGTAATAAAtaaagttaat nd [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS] W [9], [10]
remote Lrp repressor ompCp2 2313134 2313148 -277.5 ggcatccggtTGAAATAGGGGTAAAcagacattca nd [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS] W [9], [10]
remote Lrp repressor ompCp2 2313163 2313177 -306.5 taaagaagggTAAAAAAAACCGAATgcgaggcatc nd [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS] W [9], [10]
remote Lrp repressor ompCp2 2313199 2313213 -342.0 gtttttctgtGGTAGCACAGAATAAtgaaaagtgt nd [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS] W [9], [10]
sRNA Interaction TU
sRNA TU Regulated Function Binding Sites Regulatory Mechanism Evidence (Confirmed, Strong, Weak) Reference(s)
PosLeft PosRight Target sequence (mRNA)
small regulatory RNA RybB ompC repressor 2312750 2312782 GUUAUUAACCCUCUGUUAUAUGCCUUUAUUUGC nd [AS-HYPO], [EXP-IEP], [EXP-IPI] [5], [6]
small regulatory RNA RseX ompC repressor 2312750 2312780 GUUAUUAACCCUCUGUUAUAUGCCUUUAUUU MRNA-DEGRADATION [EXP-IEP] [8]
small regulatory RNA MicC ompC repressor 2312764 2312790 GUUAUAUGCCUUUAUUUGCUUUUUUAU TRANSLATION-BLOCKING [EXP-IEP], [EXP-IMP-SITE-MUTATION] [7]


Transcription unit          
Name: ompC
Gene(s): ompC   Genome Browser M3D Gene expression COLOMBOS
Note(s): EvgA, the transcriptional activator of the two-component regulatory system EvgS/EvgA, positively regulates the transcription of the ompC gene, which codes for an outer membrane porin Utsumi R, Katayama S, Taniguchi M, Horie T, Ikeda M, Igaki S, Nakagawa H, Miwa A, Tanabe H, Noda M,1994. Utsumi R, Katayama S, Ikeda M, Igaki S, Nakagawa H, Miwa A, Taniguchi M, Noda M,1992
It was proved in an experiment with increasing concentrations of the antibiotic tetracycline that the ompC gene is induced in low concentrations (1.5 and 4 mg/L), but not in high ones (10 mg/L); this suggests that the product of this gene plays a role under this condition Viveiros M, Dupont M, Rodrigues L, Couto I, Davin-Regli A, Martins M, Pagès JM, Amaral L,2007
Binding of Lrp to one site enhances occupancy of the other sites for Lrp in the ompCp3 promoter. Leucine does not abolish DNA binding by the ligated Lrp but it may alter the affinity of Lrp for specific sites on DNA.
The expression of the gene ompC is increased under acidic growth conditions in either aerobiosis or microaerobiosis Marzan LW,2013 The increased expression under aerobiosis appears to be caused by the transcription factor PhoB Marzan LW,2013 but it is not known which promoter, of three transcribing ompC, is affected by PhoB.
Evidence: [EXP-IDA-TRANSCRIPT-LEN-DETERMINATION] Length of transcript experimentally determined
Reference(s): [1] Huang L., et al., 1990
Promoter
Name: ompCp3
+1: 2312887
Distance from start of the gene: 138
Sequence: cttaaaaagttcccttgcatttacattttgaaacatctatagcgataaatgaaacatcttAaaagttttagtatcatattc
Evidence: [EXP-IDA-TRANSCRIPTION-INIT-MAPPING]
Reference(s): [1] Huang L., et al., 1990
Terminator(s)
Type: rho-independent
Sequence: caatgaaaaaAGGGCCCGCAGGCCCtttgttcgat
Reference(s): [2] Mizuno T., et al., 1983
TF binding sites (TFBSs)
[IHF,-] Phrase
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence Confidence level (C: Confirmed, S: Strong, W: Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
remote IHF repressor ompCp3 2313006 2313018 -125.0 tacttaagaaTAAGTTATTGATTttaaccttga nd [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [COMP-HINF-SIMILAR-TO-CONSENSUS], [EXP-IDA-BINDING-OF-CELLULAR-EXTRACTS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS] C nd
[Lrp,-] Phrase
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence Confidence level (C: Confirmed, S: Strong, W: Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
remote Lrp repressor ompCp3 2312738 2312752 143.0 gagggttaatAACATGAAAGTTAAAgtactgtccc nd [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS] W [9], [10]
remote Lrp repressor ompCp3 2312759 2312773 121.5 agcaaataaaGGCATATAACAGAGGgttaataaca nd [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS] W [9], [10]
remote Lrp repressor ompCp3 2312822 2312836 59.0 tttggggagaATGGACTTGCCGACTgattaatgag nd [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS] W [9], [10]
proximal Lrp repressor ompCp3 2312853 2312867 28.0 gtatcatattCGTGTTGGATTATTCtgcatttttg nd [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [COMP-AINF-SIMILAR-TO-CONSENSUS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS] W [9], [10], [21]
remote Lrp repressor ompCp3 2313031 2313045 -151.0 tttgttttgaCATTCAGTGCTGTCAaatacttaag nd [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS] W [9], [10]
remote Lrp repressor ompCp3 2313103 2313117 -223.5 ttcagaaatgAATGACGGTAATAAAtaaagttaat nd [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS] W [9], [10]
remote Lrp repressor ompCp3 2313134 2313148 -254.5 ggcatccggtTGAAATAGGGGTAAAcagacattca nd [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS] W [9], [10]
remote Lrp repressor ompCp3 2313163 2313177 -283.5 taaagaagggTAAAAAAAACCGAATgcgaggcatc nd [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS] W [9], [10]
remote Lrp repressor ompCp3 2313199 2313213 -319.0 gtttttctgtGGTAGCACAGAATAAtgaaaagtgt nd [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS] W [9], [10]
sRNA Interaction TU
sRNA TU Regulated Function Binding Sites Regulatory Mechanism Evidence (Confirmed, Strong, Weak) Reference(s)
PosLeft PosRight Target sequence (mRNA)
small regulatory RNA MicC ompC repressor 2312764 2312790 GUUAUAUGCCUUUAUUUGCUUUUUUAU TRANSLATION-BLOCKING [EXP-IEP], [EXP-IMP-SITE-MUTATION] [7]
small regulatory RNA RseX ompC repressor 2312750 2312780 GUUAUUAACCCUCUGUUAUAUGCCUUUAUUU MRNA-DEGRADATION [EXP-IEP] [8]
small regulatory RNA RybB ompC repressor 2312750 2312782 GUUAUUAACCCUCUGUUAUAUGCCUUUAUUUGC nd [AS-HYPO], [EXP-IEP], [EXP-IPI] [5], [6]


Evidence    

 [COMP-AINF] Inferred computationally without human oversight

 [EXP-IDA-HPT-TRANSCR-INIT-M-RACE-MAP] High-throughput transcription initiation mapping

 [EXP-IDA-TRANSCRIPTION-INIT-MAPPING] Transcription initiation mapping

 [EXP-IEP-GENE-EXPRESSION-ANALYSIS] Gene expression analysis

 [COMP-AINF-SIMILAR-TO-CONSENSUS] Automated inference based on similarity to consensus sequences

 [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS] Binding of purified proteins

 [EXP-IMP] Inferred from mutant phenotype

 [COMP-HINF-SIMILAR-TO-CONSENSUS] A person inferred or reviewed a computer inference of sequence function based on similarity to a consensus sequence.

 [EXP-IDA-BINDING-OF-CELLULAR-EXTRACTS] Binding of cellular extracts

 [EXP-CHIP-SEQ] high throughput ChIP-seq evidence

 [EXP-IMP-SITE-MUTATION] Site mutation

 [EXP-DAP-SEQ] high throughput DNA Affinity Purification (DAP) Sequencing

 [AS-HYPO] Author hypothesis

 [EXP-IEP] Inferred from expression pattern

 [EXP-IPI] Inferred from physical interaction


Reference(s)    

 [1] Huang L., Tsui P., Freundlich M., 1990, Integration host factor is a negative effector of in vivo and in vitro expression of ompC in Escherichia coli., J Bacteriol 172(9):5293-8

 [2] Mizuno T., Chou MY., Inouye M., 1983, A comparative study on the genes for three porins of the Escherichia coli outer membrane. DNA sequence of the osmoregulated ompC gene., J Biol Chem 258(11):6932-40

 [3] Huerta AM., Collado-Vides J., 2003, Sigma70 promoters in Escherichia coli: specific transcription in dense regions of overlapping promoter-like signals., J Mol Biol 333(2):261-78

 [4] Mendoza-Vargas A., Olvera L., Olvera M., Grande R., Vega-Alvarado L., Taboada B., Jimenez-Jacinto V., Salgado H., Juarez K., Contreras-Moreira B., Huerta AM., Collado-Vides J., Morett E., 2009, Genome-wide identification of transcription start sites, promoters and transcription factor binding sites in E. coli., PLoS One 4(10):e7526

 [5] Johansen J., Rasmussen AA., Overgaard M., Valentin-Hansen P., 2006, Conserved small non-coding RNAs that belong to the sigmaE regulon: role in down-regulation of outer membrane proteins., J Mol Biol 364(1):1-8

 [6] Lalaouna D., Carrier MC., Semsey S., Brouard JS., Wang J., Wade JT., Masse E., 2015, A 3' external transcribed spacer in a tRNA transcript acts as a sponge for small RNAs to prevent transcriptional noise., Mol Cell 58(3):393-405

 [7] Chen S., Zhang A., Blyn LB., Storz G., 2004, MicC, a second small-RNA regulator of Omp protein expression in Escherichia coli., J Bacteriol 186(20):6689-97

 [8] Douchin V., Bohn C., Bouloc P., 2006, Down-regulation of porins by a small RNA bypasses the essentiality of the regulated intramembrane proteolysis protease RseP in Escherichia coli., J Biol Chem 281(18):12253-9

 [9] Ernsting BR., Atkinson MR., Ninfa AJ., Matthews RG., 1992, Characterization of the regulon controlled by the leucine-responsive regulatory protein in Escherichia coli., J Bacteriol 174(4):1109-18

 [10] Ferrario M., Ernsting BR., Borst DW., Wiese DE., Blumenthal RM., Matthews RG., 1995, The leucine-responsive regulatory protein of Escherichia coli negatively regulates transcription of ompC and micF and positively regulates translation of ompF., J Bacteriol 177(1):103-13

 [11] Batchelor E., Walthers D., Kenney LJ., Goulian M., 2005, The Escherichia coli CpxA-CpxR envelope stress response system regulates expression of the porins ompF and ompC., J Bacteriol 187(16):5723-31

 [12] Coyer J., Andersen J., Forst SA., Inouye M., Delihas N., 1990, micF RNA in ompB mutants of Escherichia coli: different pathways regulate micF RNA levels in response to osmolarity and temperature change., J Bacteriol 172(8):4143-50

 [13] Gerken H., Vuong P., Soparkar K., Misra R., 2020, Roles of the EnvZ/OmpR Two-Component System and Porins in Iron Acquisition in Escherichia coli., mBio 11(3)

 [14] Mattison K., Oropeza R., Byers N., Kenney LJ., 2002, A phosphorylation site mutant of OmpR reveals different binding conformations at ompF and ompC., J Mol Biol 315(4):497-511

 [15] Miyake Y., Yamamoto K., 2020, Epistatic Effect of Regulators to the Adaptive Growth of Escherichia coli., Sci Rep 10(1):3661

 [16] Oshima T., Aiba H., Masuda Y., Kanaya S., Sugiura M., Wanner BL., Mori H., Mizuno T., 2002, Transcriptome analysis of all two-component regulatory system mutants of Escherichia coli K-12., Mol Microbiol 46(1):281-91

 [17] Tsung K., Brissette RE., Inouye M., 1989, Identification of the DNA-binding domain of the OmpR protein required for transcriptional activation of the ompF and ompC genes of Escherichia coli by in vivo DNA footprinting., J Biol Chem 264(17):10104-9

 [18] Yoshida T., Qin L., Egger LA., Inouye M., 2006, Transcription regulation of ompF and ompC by a single transcription factor, OmpR., J Biol Chem 281(25):17114-23

 [19] Wiebe H., Gurlebeck D., Gross J., Dreck K., Pannen D., Ewers C., Wieler LH., Schnetz K., 2015, YjjQ Represses Transcription of flhDC and Additional Loci in Escherichia coli., J Bacteriol 197(16):2713-20

 [20] Qin L., Yoshida T., Inouye M., 2001, The critical role of DNA in the equilibrium between OmpR and phosphorylated OmpR mediated by EnvZ in Escherichia coli., Proc Natl Acad Sci U S A 98(3):908-13

 [21] Fraenkel YM., Mandel Y., Friedberg D., Margalit H., 1995, Identification of common motifs in unaligned DNA sequences: application to Escherichia coli Lrp regulon., Comput Appl Biosci 11(4):379-87

 [22] Lundrigan MD., Earhart CF., 1984, Gene envY of Escherichia coli K-12 affects thermoregulation of major porin expression., J Bacteriol 157(1):262-8

 [23] Iosub IA., Marchioretto M., van Nues RW., McKellar S., Viero G., Granneman S., 2021, The mRNA derived MalH sRNA contributes to alternative carbon source utilization by tuning maltoporin expression in E. coli., RNA Biol 18(6):914-931

RegulonDB