RegulonDB

Regulon
Regulated gene(s)	acrD, aroG, bacA, baeR, baeS, bamE, cheA, cheW, cpxA, cpxP, cpxQ, cpxR, csgA, csgB, csgC, csgD, csgE, csgF, csgG, cyaR, degP, dgcZ, dsbA, dsbC, efeU, fabZ, ftnB, hha, kbp, ldtC, ldtD, lpxA, lpxD, marA, marB, marR, mdtA, mdtB, mdtC, mdtD, motA, motB, motR, mscM, mzrA, ompC, ompF, ppiA, ppiD, psd, rpoE, rpoH, rprA, rseA, rseB, rseC, rseD, sbmA, skp, slt, spy, srkA, tomB, tsr, ung, yccA, yebE, yidQ, yqaE, yqjA Read more >
Multifun term(s) of regulated gene(s)	MultiFun Term (List of genes associated to the multifun term) membrane (21) acrD, bacA, baeS, bamE, cpxA, csgF, mdtA, mdtB, mdtC, mdtD, motA, motB, mscM, ppiD, psd, rseC, sbmA, tsr, yaiW, yccA, yqjA Transcription related (12) baeR, cpxR, csgD, hha, marA, marR, rpoE, rpoH, rseA, rseB, rseC, yaiW other (mechanical, nutritional, oxidative stress) (9) cpxA, cpxP, degP, ppiD, rpoE, rseA, rseB, rseC, srkA chaperoning, repair (refolding) (7) cpxP, dsbA, dsbC, ppiA, ppiD, skp, spy drug resistance/sensitivity (6) acrD, bacA, marA, marB, marR, sbmA motility, chemotaxis, energytaxis (aerotaxis, redoxtaxis etc) (6) cheA, cheW, dgcZ, motA, motB, tsr two component regulatory systems (external signal) (5) baeR, baeS, cpxA, cpxP, cpxR temperature extremes (5) degP, ppiD, rpoE, rpoH, rseA sigma factors, anti-sigmafactors (5) rpoE, rpoH, rseA, rseB, rseC activator (4) baeR, cpxR, csgD, marA posttranslational modification (4) baeS, cheA, cpxA, srkA repressor (4) cpxR, csgD, marA, marR antisense RNA (4) cyaR, cyaR, rprA, rprA covalent modification, demodification, maturation (3) baeS, cpxA, srkA proteins/peptides/glycopeptides (3) cpxR, degP, slt detoxification (3) cpxR, marA, marB fimbri, pili (3) csgA, csgC, csgF Porters (Uni-, Sym- and Antiporters) (3) mdtB, mdtC, mdtD inhibition / activation of enzymes (2) cheW, tsr posttranscriptional (2) cpxQ, mzrA defense/survival (2) csgA, csgC Channel-type Transporters (2) csgG, mscM turnover, degradation (2) degP, yccA osmotic pressure (2) kbp, mscM murein (peptidoglycan) (2) ldtC, ldtD lipid A (2) lpxA, lpxD surface antigens (ECA, O antigen of LPS) (2) lpxA, lpxD operon (2) marA, marR Putative uncharacterized transport protein (2) marB, yccA Beta barrel porins (The Outer Membrane Porin (OMP) Functional Superfamily) (2) ompC, ompF stimulon (2) rpoE, rpoH starvation (2) rseB, rseC Electrochemical potential driven transporters (1) acrD phenylalanine (1) aroG pH (1) cpxP glycoprotein (1) csgB pilus (1) csgB Accessory Factors Involved in Transport (1) csgE adaptations (1) dsbA fatty acids and phosphatidic acid (1) fabZ Fe aquisition (1) ftnB complex regulation (1) hha global (1) hha cell killing (1) hha alpha-type channels (1) motA flagella (1) motB phospholipid (1) psd translation attenuation and efficiency (1) rprA ABC superfamily, ATP binding and membrane component (1) sbmA protection (1) spy cell processes (1) tomB DNA repair (1) ung transcriptional level (1) yaiW energy production/transport (1) yqjA Read more >
Regulated operon(s)	acrD, aroG, bacA, bamA-skp-lpxD-fabZ-lpxAB-rnhB-dnaE, bamE, cpxPQ, cpxRA, csgBAC, csgDEFG, cyaR, degP, dgcZ, efeU, ftnB, ldtC, ldtD, marRAB, mdtABCD-baeSR, motRAB-cheAW, ompC, ompF, ppiA, ppiD, psd-mscM, rpoH, rprA, rseD-rpoE-rseABC, sbmA-yaiW, slt, spy, srkA-dsbA, tomB-hha, tsr, ung, xerD-dsbC-recJ-prfB-lysS, yccA, yebE, yidQ, yqaE-kbp, yqjA-mzrA
First gene in the operon(s)	acrD, aroG, bacA, bamE, cpxP, cpxR, csgB, csgD, cyaR, degP, dgcZ, dsbC, efeU, ftnB, skp, ldtC, ldtD, marR, mdtA, motR, ompC, ompF, ppiA, ppiD, psd, rseD, rpoH, rprA, sbmA, slt, spy, srkA, tomB, tsr, ung, yccA, yebE, yidQ, yqaE, yqjA
Simple and complex regulons	AcrR,CRP,CpxR,Cra,Fis,MarA,MarR,Rob,SoxS BaeR,CpxR BasR,BolA,BtsR,CRP,CpxR,Cra,CsgD,FliZ,H-NS,IHF,MlrA,MqsA,OmpR,RcdA,RcsAB,RstA,ppGpp BasR,BtsR,CRP,CpxR,Cra,CsgD,FliZ,H-NS,IHF,MlrA,MqsA,OmpR,RcdA,RcsAB,RstA BasR,CpxR,PdhR BtsR,CpxR,CsgD,FliZ CRP,CpxR CRP,CpxR,EnvY,Fur,IHF,OmpR,PhoB,RstA CpxR CpxR,CysB CpxR,EnvY,IHF,Lrp,OmpR,YjjQ CpxR,GadE CpxR,H-NS CpxR,NsrR CpxR,RcsB CpxR,TyrR Read more >
Simple and complex regulatory phrases	Regulatory phrase (List of promoters regulated by the phrase) [CpxR,+](31) acrDp2, aroGp, bacAp, cpxPp, cpxRp, cpxRp2, degPp, dgcZp, dsbCp, ftnBp2, hlpAp, ldtCp, ldtDp, marRp, mdtAp, ompCp1, ppiAp1, ppiDp2, rpoHp1, rpoHp2, rprAp, sbmAp, sltp7, spyp, srkAp, tomBp, yccAp, yebEp, yidQp, yqaEp, yqjAp1 [CpxR,-](16) bamEp, csgBp, csgBp2, csgDp1, csgDp3, cyaRp, cyaRp2, cyaRp3, efeUp, motRp, ompFp, ompFp2, psdp, rpoEp1a, tsrp1, ungp

Transcription factor binding sites (TFBSs) arrangements

Functional conformation	Function	Promoter	Sigma factor	Central Rel-Pos	Distance to first Gene	Genes	Sequence	LeftPos	RightPos	Evidence	Confidence level (C: Confirmed, S: Strong, W: Weak)	References
CpxR-phosphorylated	activator	acrDp2	Sigma54	-127.5	-172.5	acrD	ggagggtgagGAAAGTCAGTTAATGTAATgcctcctact nd	2587414	2587432	[EXP-IEP-GENE-EXPRESSION-ANALYSIS], [IC], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS], [IC]	S	[4], [4]
CpxR-phosphorylated	activator	acrDp2	Sigma54	-98.0	-143.0	acrD	tcctactgacCAAAGAATACTTGCacttaaggtt nd	2587446	2587459	[IC], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS], [IC]	S	[4], [4]
CpxR-phosphorylated	activator	acrDp2	Sigma54	-66.0	-111.0	acrD	ggttcagtatAAAAGGGCATGATAATTTacattaactc nd	2587476	2587493	[EXP-IEP-GENE-EXPRESSION-ANALYSIS], [IC], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS], [IC]	S	[4], [4]
CpxR-phosphorylated	activator	aroGp	Sigma70	-38.0	-80.0	aroG	agtgtaaaacCccgtttacac nd	785552	785553	[COMP-HINF-SIMILAR-TO-CONSENSUS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS]	S	[3], [3]
CpxR-phosphorylated	activator	bacAp	Sigma24	-292.0	-336.0	bacA	accgtaaagcGgcgaaaagtg nd	3204466	3204467	[COMP]	W	[5], [5]
CpxR-phosphorylated	repressor	bamEp	Sigma24	11.0	-109.0	bamE	acagcaaaacGccgtaagacc nd	2753495	2753496	[COMP]	W	[5], [5]
CpxR-phosphorylated	activator	cpxPp	Sigma70	-52.0	-87.0	cpxP, cpxQ	gactttacgtTgttttacacc nd	4105732	4105733	[EXP-IEP-GENE-EXPRESSION-ANALYSIS], [COMP-HINF-SIMILAR-TO-CONSENSUS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS]	S	[1], [3], [3], [6], [6], [7]
CpxR-phosphorylated	activator	cpxPp	Sigma70	-32.0	-67.0	cpxP, cpxQ	cccctgacgcAtgtttgcagc nd	4105752	4105753	[COMP-HINF-SIMILAR-TO-CONSENSUS], [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [COMP-HINF-SIMILAR-TO-CONSENSUS], [EXP-CHIP-EXO]	S	[6], [6], [7], [8]
CpxR-phosphorylated	activator	cpxPp	Sigma70	-5.0	-40.0	cpxP, cpxQ	agcctgaatcGTAAACTCTCTATCGTTGAAtcgcgacaga nd	4105771	4105790	[EXP-IEP-GENE-EXPRESSION-ANALYSIS], [COMP-HINF-SIMILAR-TO-CONSENSUS], [EXP-CHIP-EXO], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS]	C	[3], [3], [6], [7], [8]
CpxR-phosphorylated	activator	cpxRp	Sigma70	-67.0	-83.0	cpxR, cpxA	gctgcaaacaTgcgtcagggg nd	4105752	4105753	[EXP-IEP-GENE-EXPRESSION-ANALYSIS], [COMP-HINF-SIMILAR-TO-CONSENSUS], [EXP-CHIP-EXO]	S	[6], [6], [7], [8]
CpxR-phosphorylated	activator	cpxRp	Sigma70	-47.0	-63.0	cpxR, cpxA	ggtgtaaaacAacgtaaagtc nd	4105732	4105733	[EXP-IEP-GENE-EXPRESSION-ANALYSIS], [COMP-HINF-SIMILAR-TO-CONSENSUS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS]	S	[1], [3], [6], [6], [7]
CpxR-phosphorylated	activator	cpxRp2	Sigma38	-67.0	-83.0	cpxR, cpxA	gctgcaaacaTgcgtcagggg nd	4105752	4105753	[EXP-IEP-GENE-EXPRESSION-ANALYSIS], [COMP-HINF-SIMILAR-TO-CONSENSUS], [EXP-CHIP-EXO]	S	[6], [6], [7], [8]
CpxR-phosphorylated	activator	cpxRp2	Sigma38	-47.0	-63.0	cpxR, cpxA	ggtgtaaaacAacgtaaagtc nd	4105732	4105733	[EXP-IEP-GENE-EXPRESSION-ANALYSIS], [COMP-HINF-SIMILAR-TO-CONSENSUS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS]	S	[1], [3], [6], [6], [7]
CpxR-phosphorylated	repressor	csgBp	Sigma70	-464.0	-556.0	csgB, csgA, csgC	acatgtaactAaatgtaactc nd	1103394	1103395	[EXP-IEP-GENE-EXPRESSION-ANALYSIS], [COMP-HINF-SIMILAR-TO-CONSENSUS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS]	S	[9], [9]
CpxR-phosphorylated	repressor	csgBp	Sigma70	-255.0	-347.0	csgB, csgA, csgC	ccgtggacaaTtttttactgc nd	1103603	1103604	[COMP-HINF-SIMILAR-TO-CONSENSUS]	W	[5], [5]
CpxR-phosphorylated	repressor	csgBp	Sigma70	8.0	-85.0	csgB, csgA, csgC	atcgtaacgcAgcgttaacaa nd	1103865	1103866	[EXP-IEP-GENE-EXPRESSION-ANALYSIS], [COMP-AINF-SIMILAR-TO-CONSENSUS], [COMP-HINF-SIMILAR-TO-CONSENSUS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS]	S	[5], [5], [9], [9]
CpxR-phosphorylated	repressor	csgBp2	Sigma38	-464.0	-556.0	csgB, csgA, csgC	acatgtaactAaatgtaactc nd	1103394	1103395	[EXP-IEP-GENE-EXPRESSION-ANALYSIS], [COMP-HINF-SIMILAR-TO-CONSENSUS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS]	S	[9], [9]
CpxR-phosphorylated	repressor	csgBp2	Sigma38	-255.0	-347.0	csgB, csgA, csgC	ccgtggacaaTtttttactgc nd	1103603	1103604	[COMP-HINF-SIMILAR-TO-CONSENSUS]	W	[5], [5]
CpxR-phosphorylated	repressor	csgBp2	Sigma38	8.0	-85.0	csgB, csgA, csgC	atcgtaacgcAgcgttaacaa nd	1103865	1103866	[EXP-IEP-GENE-EXPRESSION-ANALYSIS], [COMP-AINF-SIMILAR-TO-CONSENSUS], [COMP-HINF-SIMILAR-TO-CONSENSUS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS]	S	[5], [5], [9], [9]
CpxR-phosphorylated	repressor	csgDp1	Sigma70	-186.0	-334.0	csgD, csgE, csgF, csgG	tattttttatAtgcattatta nd	1103529	1103530	[EXP-IEP-GENE-EXPRESSION-ANALYSIS], [COMP-HINF-SIMILAR-TO-CONSENSUS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS]	S	[10], [10]
CpxR-phosphorylated	repressor	csgDp1	Sigma70	-178.0	-326.0	csgD, csgE, csgF, csgG	attttttataTGCATTATTAGTAAgttatcacca nd	1103516	1103529	[EXP-IEP-GENE-EXPRESSION-ANALYSIS], [COMP-HINF-SIMILAR-TO-CONSENSUS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS]	S	[10], [10]
CpxR-phosphorylated	repressor	csgDp1	Sigma70	-166.0	-314.0	csgD, csgE, csgF, csgG	agtaagttatCaccatttgta nd	1103509	1103510	[EXP-IEP-GENE-EXPRESSION-ANALYSIS], [COMP-HINF-SIMILAR-TO-CONSENSUS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS]	S	[10], [10]
CpxR-phosphorylated	repressor	csgDp1	Sigma70	-141.0	-289.0	csgD, csgE, csgF, csgG	tttttaaaatTgtgcaataaa nd	1103484	1103485	[EXP-IEP-GENE-EXPRESSION-ANALYSIS], [COMP-HINF-SIMILAR-TO-CONSENSUS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS]	S	[10], [10]
CpxR-phosphorylated	repressor	csgDp1	Sigma70	-129.5	-277.5	csgD, csgE, csgF, csgG	ttaaaattgtGCAATAAAAACCAAATGtacaactttt nd	1103466	1103482	[EXP-IEP-GENE-EXPRESSION-ANALYSIS], [COMP-HINF-SIMILAR-TO-CONSENSUS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS]	S	[10], [10]
CpxR-phosphorylated	repressor	csgDp1	Sigma70	-108.5	-256.5	csgD, csgE, csgF, csgG	aaatgtacaaCTTTTCTATCATTTCtaaacttaat nd	1103446	1103460	[EXP-IEP-GENE-EXPRESSION-ANALYSIS], [COMP-HINF-SIMILAR-TO-CONSENSUS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS]	S	[10], [10]
CpxR-phosphorylated	repressor	csgDp1	Sigma70	-100.0	-248.0	csgD, csgE, csgF, csgG	tatcatttctAaacttaataa nd	1103443	1103444	[EXP-IEP-GENE-EXPRESSION-ANALYSIS], [COMP-HINF-SIMILAR-TO-CONSENSUS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS]	S	[10], [10], [11], [11]
CpxR-phosphorylated	repressor	csgDp1	Sigma70	-95.5	-243.5	csgD, csgE, csgF, csgG	ttctatcattTCTAAACTTAATAAAaccttaaggt nd	1103433	1103447	[EXP-IEP-GENE-EXPRESSION-ANALYSIS], [COMP-HINF-SIMILAR-TO-CONSENSUS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS]	S	[10], [10]
CpxR-phosphorylated	repressor	csgDp1	Sigma70	-73.5	-221.5	csgD, csgE, csgF, csgG	aaaaccttaaGGTTAACATTTTAATataacgagtt nd	1103411	1103425	[EXP-IEP-GENE-EXPRESSION-ANALYSIS], [COMP-HINF-SIMILAR-TO-CONSENSUS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS]	S	[10], [10]
CpxR-phosphorylated	repressor	csgDp1	Sigma70	-52.0	-200.0	csgD, csgE, csgF, csgG	cgagttacatTtagttacatg nd	1103395	1103396	[EXP-IEP-GENE-EXPRESSION-ANALYSIS], [COMP-HINF-SIMILAR-TO-CONSENSUS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS]	S	[9], [9], [11], [11]
CpxR-phosphorylated	repressor	csgDp1	Sigma70	-48.0	-196.0	csgD, csgE, csgF, csgG	ttacatttagTtacatgttta nd	1103391	1103392	[EXP-IEP-GENE-EXPRESSION-ANALYSIS], [COMP-HINF-SIMILAR-TO-CONSENSUS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS]	S	[11], [11]
CpxR-phosphorylated	repressor	csgDp1	Sigma70	-43.0	-191.0	csgD, csgE, csgF, csgG	tttagttacaTgtttaacact nd	1103386	1103387	[EXP-IEP-GENE-EXPRESSION-ANALYSIS], [COMP-HINF-SIMILAR-TO-CONSENSUS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS]	S	[10], [10]
CpxR-phosphorylated	repressor	csgDp1	Sigma70	-21.5	-169.5	csgD, csgE, csgF, csgG	taacacttgaTTTAAGATTTGTAATggctagattg nd	1103359	1103373	[EXP-IEP-GENE-EXPRESSION-ANALYSIS], [COMP-HINF-SIMILAR-TO-CONSENSUS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS]	S	[10], [10], [11], [11]
CpxR-phosphorylated	repressor	csgDp1	Sigma70	3.0	-146.0	csgD, csgE, csgF, csgG	attgaaatcaGatgtaatcca nd	1103341	1103342	[EXP-IEP-GENE-EXPRESSION-ANALYSIS], [COMP-HINF-SIMILAR-TO-CONSENSUS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS]	S	[11], [11]
CpxR-phosphorylated	repressor	csgDp3	Sigma38	-186.0	-334.0	csgD, csgE, csgF, csgG	tattttttatAtgcattatta nd	1103529	1103530	[EXP-IEP-GENE-EXPRESSION-ANALYSIS], [COMP-HINF-SIMILAR-TO-CONSENSUS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS]	S	[10], [10]
CpxR-phosphorylated	repressor	csgDp3	Sigma38	-178.0	-326.0	csgD, csgE, csgF, csgG	attttttataTGCATTATTAGTAAgttatcacca nd	1103516	1103529	[EXP-IEP-GENE-EXPRESSION-ANALYSIS], [COMP-HINF-SIMILAR-TO-CONSENSUS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS]	S	[10], [10]
CpxR-phosphorylated	repressor	csgDp3	Sigma38	-166.0	-314.0	csgD, csgE, csgF, csgG	agtaagttatCaccatttgta nd	1103509	1103510	[EXP-IEP-GENE-EXPRESSION-ANALYSIS], [COMP-HINF-SIMILAR-TO-CONSENSUS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS]	S	[10], [10]
CpxR-phosphorylated	repressor	csgDp3	Sigma38	-141.0	-289.0	csgD, csgE, csgF, csgG	tttttaaaatTgtgcaataaa nd	1103484	1103485	[EXP-IEP-GENE-EXPRESSION-ANALYSIS], [COMP-HINF-SIMILAR-TO-CONSENSUS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS]	S	[10], [10]
CpxR-phosphorylated	repressor	csgDp3	Sigma38	-129.5	-277.5	csgD, csgE, csgF, csgG	ttaaaattgtGCAATAAAAACCAAATGtacaactttt nd	1103466	1103482	[EXP-IEP-GENE-EXPRESSION-ANALYSIS], [COMP-HINF-SIMILAR-TO-CONSENSUS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS]	S	[10], [10]
CpxR-phosphorylated	repressor	csgDp3	Sigma38	-108.5	-256.5	csgD, csgE, csgF, csgG	aaatgtacaaCTTTTCTATCATTTCtaaacttaat nd	1103446	1103460	[EXP-IEP-GENE-EXPRESSION-ANALYSIS], [COMP-HINF-SIMILAR-TO-CONSENSUS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS]	S	[10], [10]
CpxR-phosphorylated	repressor	csgDp3	Sigma38	-100.0	-248.0	csgD, csgE, csgF, csgG	tatcatttctAaacttaataa nd	1103443	1103444	[EXP-IEP-GENE-EXPRESSION-ANALYSIS], [COMP-HINF-SIMILAR-TO-CONSENSUS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS]	S	[10], [10], [11], [11]
CpxR-phosphorylated	repressor	csgDp3	Sigma38	-95.5	-243.5	csgD, csgE, csgF, csgG	ttctatcattTCTAAACTTAATAAAaccttaaggt nd	1103433	1103447	[EXP-IEP-GENE-EXPRESSION-ANALYSIS], [COMP-HINF-SIMILAR-TO-CONSENSUS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS]	S	[10], [10]
CpxR-phosphorylated	repressor	csgDp3	Sigma38	-73.5	-221.5	csgD, csgE, csgF, csgG	aaaaccttaaGGTTAACATTTTAATataacgagtt nd	1103411	1103425	[EXP-IEP-GENE-EXPRESSION-ANALYSIS], [COMP-HINF-SIMILAR-TO-CONSENSUS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS]	S	[10], [10]
CpxR-phosphorylated	repressor	csgDp3	Sigma38	-52.0	-200.0	csgD, csgE, csgF, csgG	cgagttacatTtagttacatg nd	1103395	1103396	[EXP-IEP-GENE-EXPRESSION-ANALYSIS], [COMP-HINF-SIMILAR-TO-CONSENSUS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS]	S	[9], [9], [11], [11]
CpxR-phosphorylated	repressor	csgDp3	Sigma38	-48.0	-196.0	csgD, csgE, csgF, csgG	ttacatttagTtacatgttta nd	1103391	1103392	[EXP-IEP-GENE-EXPRESSION-ANALYSIS], [COMP-HINF-SIMILAR-TO-CONSENSUS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS]	S	[11], [11]
CpxR-phosphorylated	repressor	csgDp3	Sigma38	-43.0	-191.0	csgD, csgE, csgF, csgG	tttagttacaTgtttaacact nd	1103386	1103387	[EXP-IEP-GENE-EXPRESSION-ANALYSIS], [COMP-HINF-SIMILAR-TO-CONSENSUS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS]	S	[10], [10]
CpxR-phosphorylated	repressor	csgDp3	Sigma38	-21.5	-169.5	csgD, csgE, csgF, csgG	taacacttgaTTTAAGATTTGTAATggctagattg nd	1103359	1103373	[EXP-IEP-GENE-EXPRESSION-ANALYSIS], [COMP-HINF-SIMILAR-TO-CONSENSUS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS]	S	[10], [10], [11], [11]
CpxR-phosphorylated	repressor	csgDp3	Sigma38	3.0	-146.0	csgD, csgE, csgF, csgG	attgaaatcaGatgtaatcca nd	1103341	1103342	[EXP-IEP-GENE-EXPRESSION-ANALYSIS], [COMP-HINF-SIMILAR-TO-CONSENSUS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS]	S	[11], [11]
CpxR-phosphorylated	repressor	cyaRp	Sigma70	nd	nd	cyaR	nd nd	nd	nd	[EXP-IEP-GENE-EXPRESSION-ANALYSIS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS]	S	[12], [12]
CpxR-phosphorylated	repressor	cyaRp2	Sigma24	nd	nd	cyaR	nd nd	nd	nd	[EXP-IEP-GENE-EXPRESSION-ANALYSIS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS]	S	[12], [12]
CpxR-phosphorylated	repressor	cyaRp3	Sigma38	nd	nd	cyaR	nd nd	nd	nd	[EXP-IEP-GENE-EXPRESSION-ANALYSIS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS]	S	[12], [12]
CpxR-phosphorylated	activator	degPp	Sigma24	-223.0	-262.0	degP	tcagtaaattAccgtcagatt nd	180621	180622	[EXP-IEP-GENE-EXPRESSION-ANALYSIS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS]	S	[1], [13]
CpxR-phosphorylated	activator	degPp	Sigma24	-71.5	-110.5	degP	ccaggcttttGTAAAGACGAACAATAAATttttaccttt nd	180765	180783	[EXP-IEP-GENE-EXPRESSION-ANALYSIS], [COMP-AINF-SIMILAR-TO-CONSENSUS], [COMP-HINF-SIMILAR-TO-CONSENSUS], [EXP-CHIP-EXO], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS]	C	[1], [1], [3], [3], [8], [13]
CpxR-phosphorylated	activator	degPp	Sigma24	-63.0	-102.0	degP	cgaacaataaAtttttacctt nd	180781	180782	[EXP-IEP-GENE-EXPRESSION-ANALYSIS], [COMP-HINF-SIMILAR-TO-CONSENSUS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS]	S	[1], [1], [13]
CpxR-phosphorylated	activator	dgcZp	Sigma70	-41.0	-70.0	dgcZ	aacttcggatTTCTATGAAAATATTGACgtaattttgc nd	1623912	1623929	[EXP-IEP-GENE-EXPRESSION-ANALYSIS], [COMP-HINF-SIMILAR-TO-CONSENSUS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS]	S	[3], [3], [7]
CpxR-phosphorylated	activator	dsbCp	Sigma24	-391.5	-403.5	dsbC	acgggtcattGGTAAAGGCAACAAAgagcgtctgg nd	3039219	3039233	[EXP-IEP-GENE-EXPRESSION-ANALYSIS], [COMP-HINF-SIMILAR-TO-CONSENSUS]	W	[14], [14]
CpxR-phosphorylated	activator	dsbCp	Sigma24	-357.5	-369.5	dsbC	taggtgaagaGgcggtttact nd	3039191	3039192	[EXP-IEP-GENE-EXPRESSION-ANALYSIS], [COMP-HINF-SIMILAR-TO-CONSENSUS]	W	[14], [14]
CpxR-phosphorylated	repressor	efeUp	Sigma70	-54.5	-103.5	efeU	ccaacatcatTTTATAAACATTCCGcttgtgtttt nd	1081246	1081260	[EXP-IEP-GENE-EXPRESSION-ANALYSIS], [COMP-HINF-SIMILAR-TO-CONSENSUS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS]	S	[3], [3], [7]
CpxR-phosphorylated	activator	ftnBp2	Sigma70	-61.0	-187.0	ftnB	aatgtaaaaaTatataaactt nd	1986737	1986738	[COMP-HINF-SIMILAR-TO-CONSENSUS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS]	S	[3], [3]
CpxR-phosphorylated	activator	hlpAp	Sigma24	-101.0	-128.0	skp, lpxD, fabZ, lpxA	tcggtaaaacCtggtaagtgt nd	200353	200354	[EXP-IEP-GENE-EXPRESSION-ANALYSIS], [COMP-HINF-SIMILAR-TO-CONSENSUS]	W	[14], [14]
CpxR-phosphorylated	activator	ldtCp	Sigma70	-53.5	-96.5	ldtC	catctgcaacATTTACAAATTCTTTGCacttccctgc nd	1170463	1170479	[COMP-HINF-SIMILAR-TO-CONSENSUS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS]	S	[3], [3]
CpxR-phosphorylated	activator	ldtDp	nd	-192.0	-308.0	ldtD	gatttgcgccGCAACTCCCTGAAACGcttccaggaa nd	980732	980747	[EXP-IEP-GENE-EXPRESSION-ANALYSIS], [COMP-HINF-SIMILAR-TO-CONSENSUS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS]	S	[7], [15], [15]
CpxR-phosphorylated	activator	marRp	Sigma70	-29.0	-56.0	marR, marA, marB	attcattcatTTGACTTATACTTGCCtgggcaatat nd	1619057	1619072	[EXP-IEP-GENE-EXPRESSION-ANALYSIS], [COMP-HINF-SIMILAR-TO-CONSENSUS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS]	S	[16], [16]
CpxR-phosphorylated	activator	mdtAp	Sigma38	-128.5	-165.5	mdtA, mdtB, mdtC, mdtD, baeS, baeR	cagtctatcgCTAACGCGTAGATAAAAtagtttcctg nd	2153843	2153859	[EXP-IEP-GENE-EXPRESSION-ANALYSIS], [IC], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS], [IC]	S	[4], [4]
CpxR-phosphorylated	activator	mdtAp	Sigma38	-66.5	-103.5	mdtA, mdtB, mdtC, mdtD, baeS, baeR	atgtgcccgtCATTCAGACGATTCCagacagtgtt nd	2153906	2153920	[EXP-IEP-GENE-EXPRESSION-ANALYSIS], [IC], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS], [IC]	S	[4], [4]
CpxR-phosphorylated	repressor	motRp	Sigma28	-37.0	-37.0	motR, motA, motB, cheA, cheW	gcagtaaaaaGacgtaaactt nd	1977338	1977339	[EXP-IEP-GENE-EXPRESSION-ANALYSIS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS]	S	[5], [5], [6], [6]
CpxR-phosphorylated	activator	ompCp1	Sigma70	-351.0	-432.0	ompC	tgtgtaaagaAgggtaaaaaa nd	2313180	2313181	[EXP-IEP-GENE-EXPRESSION-ANALYSIS], [COMP-AINF-SIMILAR-TO-CONSENSUS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS]	S	[17], [17]
CpxR-phosphorylated	activator	ompCp1	Sigma70	-134.0	-215.0	ompC	gtgcttatttCgccattccgc nd	2312963	2312964	[EXP-IEP-GENE-EXPRESSION-ANALYSIS], [COMP-AINF-SIMILAR-TO-CONSENSUS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS]	S	[17], [17]
CpxR-phosphorylated	activator	ompCp1	Sigma70	-95.0	-176.0	ompC	aagttcccttGCATTTACATTTtgaaacatct nd	2312920	2312931	[EXP-IEP-GENE-EXPRESSION-ANALYSIS], [COMP-AINF-SIMILAR-TO-CONSENSUS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS]	S	[17], [17]
CpxR-phosphorylated	repressor	ompFp	Sigma70	-429.5	-539.5	ompF	ttttctgtcaAGTTATCTGTTTGTTAAgtcaagcaat nd	987514	987530	[EXP-IEP-GENE-EXPRESSION-ANALYSIS], [COMP-AINF-SIMILAR-TO-CONSENSUS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS]	S	[7], [17], [17]
CpxR-phosphorylated	repressor	ompFp	Sigma70	-373.0	-483.0	ompF	cctgttacggAatattacatt nd	987464	987465	[EXP-IEP-GENE-EXPRESSION-ANALYSIS], [COMP-AINF-SIMILAR-TO-CONSENSUS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS]	S	[7], [17], [17]
CpxR-phosphorylated	repressor	ompFp	Sigma70	-93.0	-203.0	ompF	aattttacttTtggttacata nd	987184	987185	[EXP-IEP-GENE-EXPRESSION-ANALYSIS], [COMP-AINF-SIMILAR-TO-CONSENSUS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS]	S	[7], [17], [17]
CpxR-phosphorylated	repressor	ompFp	Sigma70	-68.5	-178.5	ompF	acatatttttTCTTTTTGAAACCAAATctttatcttt nd	987153	987169	[EXP-IEP-GENE-EXPRESSION-ANALYSIS], [COMP-AINF-SIMILAR-TO-CONSENSUS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS]	S	[7], [17], [17]
CpxR-phosphorylated	repressor	ompFp2	Sigma38	-429.5	-539.5	ompF	ttttctgtcaAGTTATCTGTTTGTTAAgtcaagcaat nd	987514	987530	[EXP-IEP-GENE-EXPRESSION-ANALYSIS], [COMP-AINF-SIMILAR-TO-CONSENSUS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS]	S	[7], [17], [17]
CpxR-phosphorylated	repressor	ompFp2	Sigma38	-373.0	-483.0	ompF	cctgttacggAatattacatt nd	987464	987465	[EXP-IEP-GENE-EXPRESSION-ANALYSIS], [COMP-AINF-SIMILAR-TO-CONSENSUS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS]	S	[7], [17], [17]
CpxR-phosphorylated	repressor	ompFp2	Sigma38	-93.0	-203.0	ompF	aattttacttTtggttacata nd	987184	987185	[EXP-IEP-GENE-EXPRESSION-ANALYSIS], [COMP-AINF-SIMILAR-TO-CONSENSUS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS]	S	[7], [17], [17]
CpxR-phosphorylated	repressor	ompFp2	Sigma38	-68.5	-178.5	ompF	acatatttttTCTTTTTGAAACCAAATctttatcttt nd	987153	987169	[EXP-IEP-GENE-EXPRESSION-ANALYSIS], [COMP-AINF-SIMILAR-TO-CONSENSUS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS]	S	[7], [17], [17]
CpxR-phosphorylated	activator	ppiAp1	Sigma70	-47.0	-85.0	ppiA	tacgtaaaatTaggtaaaggg nd	3492381	3492382	[EXP-IEP-GENE-EXPRESSION-ANALYSIS], [COMP-HINF-SIMILAR-TO-CONSENSUS], [EXP-CHIP-EXO], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS]	C	[1], [3], [3], [8], [18]
CpxR-phosphorylated	activator	ppiDp2	Sigma70	-165.0	-261.0	ppiD	ccggtaaagaGatcaccatcg nd	461653	461654	[COMP-HINF-SIMILAR-TO-CONSENSUS], [EXP-IMP-SITE-MUTATION]	S	[19], [19]
CpxR-phosphorylated	activator	ppiDp2	Sigma70	-117.0	-213.0	ppiD	caggtaaagcActgaaagacg nd	461701	461702	[COMP-HINF-SIMILAR-TO-CONSENSUS], [EXP-IMP-SITE-MUTATION]	S	[19], [19]
CpxR-phosphorylated	activator	ppiDp2	Sigma70	-96.5	-192.5	ppiD	gaaagacgcgGTAAACTAAGCGTTGTCcccagtgggg nd	461715	461731	[COMP-HINF-SIMILAR-TO-CONSENSUS], [EXP-IMP-SITE-MUTATION]	S	[19], [19]
CpxR-phosphorylated	repressor	psdp	Sigma24	151.0	-128.0	psd, mscM	caggtaaaaaCgcgtaaaaac nd	4390487	4390488	[COMP]	W	[5], [5]
CpxR-phosphorylated	repressor	rpoEp1a	nd	67.0	45.0	rseD, rpoE, rseA, rseB, rseC	tgcgttacggAactttacaaa nd	2710119	2710120	[EXP-IEP-GENE-EXPRESSION-ANALYSIS], [COMP-AINF-SIMILAR-TO-CONSENSUS], [EXP-CHIP-EXO]	S	[5], [5], [8]
CpxR-phosphorylated	activator	rpoHp1	Sigma70	nd	nd	rpoH	nd nd	nd	nd	[EXP-IEP-GENE-EXPRESSION-ANALYSIS]	W	[20]
CpxR-phosphorylated	activator	rpoHp2	Sigma38	nd	nd	rpoH	nd nd	nd	nd	[EXP-IEP-GENE-EXPRESSION-ANALYSIS]	W	[20]
CpxR-phosphorylated	activator	rprAp	nd	nd	nd	rprA	nd nd	nd	nd	[EXP-IEP-GENE-EXPRESSION-ANALYSIS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS]	S	[12], [12]
CpxR-phosphorylated	activator	sbmAp	Sigma24	nd	nd	sbmA, yaiW	nd nd	nd	nd	[EXP-IEP-GENE-EXPRESSION-ANALYSIS], [COMP-AINF-SIMILAR-TO-CONSENSUS]	W	[7], [7]
CpxR-phosphorylated	activator	sltp7	Sigma32	-52.0	-85.0	slt	aaaagtgtccGTAACGTGGCGTAAACggcaatgact nd	4630641	4630656	[EXP-IEP-GENE-EXPRESSION-ANALYSIS], [EXP-IGI], [COMP-AINF-SIMILAR-TO-CONSENSUS], [COMP-HINF-SIMILAR-TO-CONSENSUS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS]	S	[7], [7], [15], [15]
CpxR-phosphorylated	activator	spyp	Sigma70	-50.0	-113.0	spy	acactttcatTgttttaccgt nd	1825737	1825738	[EXP-IEP-GENE-EXPRESSION-ANALYSIS], [COMP-HINF-SIMILAR-TO-CONSENSUS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS]	S	[3], [3], [7], [21], [22]
CpxR-phosphorylated	activator	srkAp	Sigma70	-49.0	-73.0	srkA, dsbA	agagtaaaagCttgtaagcgg nd	4042341	4042342	[EXP-IEP-GENE-EXPRESSION-ANALYSIS], [COMP-HINF-SIMILAR-TO-CONSENSUS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS]	S	[1], [1], [3], [3], [23]
CpxR-phosphorylated	activator	tomBp	Sigma70	-50.0	-136.0	tomB, hha	attgtaatttTtcgtaataat nd	480843	480844	[COMP-HINF-SIMILAR-TO-CONSENSUS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS]	S	[3], [3]
CpxR-phosphorylated	repressor	tsrp1	Sigma70	-9.0	-254.0	tsr	cgcgtaaagtAaggtaaataa nd	4591402	4591403	[EXP-CHIP-EXO], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS]	S	[6], [6], [8]
CpxR-phosphorylated	repressor	ungp	nd	-81.0	-97.0	ung	caatttacatTtttttgcact nd	2716656	2716657	[EXP-IDA-BINDING-OF-CELLULAR-EXTRACTS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS]	S	[24], [24]
CpxR-phosphorylated	activator	yccAp	Sigma70	-53.0	-78.0	yccA	tgcgtaaagaTgggtaaaact nd	1031495	1031496	[EXP-IEP-GENE-EXPRESSION-ANALYSIS], [COMP-HINF-SIMILAR-TO-CONSENSUS], [EXP-CHIP-EXO], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS]	C	[3], [3], [7], [8]
CpxR-phosphorylated	activator	yebEp	Sigma70	-44.0	-69.0	yebE	tcttttgtctCgatatacatt nd	1929775	1929776	[EXP-IEP-GENE-EXPRESSION-ANALYSIS], [COMP-HINF-SIMILAR-TO-CONSENSUS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS]	S	[3], [3], [7]
CpxR-phosphorylated	activator	yidQp	Sigma24	-254.0	-438.0	yidQ	tagcaatgcgGTAATGGTTTTCGTCTACcagttcaacg nd	3867282	3867299	[EXP-IEP-GENE-EXPRESSION-ANALYSIS], [COMP-HINF-SIMILAR-TO-CONSENSUS]	W	[14], [14]
CpxR-phosphorylated	activator	yidQp	Sigma24	-176.0	-360.0	yidQ	tttctaagtgGTTAAACAAACGGTCAAAtccaatagca nd	3867360	3867377	[EXP-IEP-GENE-EXPRESSION-ANALYSIS], [COMP-HINF-SIMILAR-TO-CONSENSUS]	W	[14], [14]
CpxR-phosphorylated	activator	yidQp	Sigma24	-143.5	-327.5	yidQ	tagcagaacgGTAAAGCGGGGATAAATcaaagttacg nd	3867393	3867409	[EXP-IEP-GENE-EXPRESSION-ANALYSIS], [COMP-HINF-SIMILAR-TO-CONSENSUS]	W	[14], [14]
CpxR-phosphorylated	activator	yqaEp	nd	-48.0	-105.0	yqaE, kbp	gcctcagcagCGTAAATGAGAGTAAAagcgtaagct nd	2797126	2797141	[EXP-IEP-GENE-EXPRESSION-ANALYSIS], [COMP-AINF-SIMILAR-TO-CONSENSUS], [COMP-HINF-SIMILAR-TO-CONSENSUS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS]	S	[7], [7], [12], [12], [15], [15]
CpxR-phosphorylated	activator	yqjAp1	Sigma70	-47.0	-272.0	yqjA, mzrA	agtgtcagccTgtgtaaatcc nd	3247500	3247501	[COMP-HINF-SIMILAR-TO-CONSENSUS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS]	S	[3], [3]

	Sequence
	acatgtaactAaatgtaactc	[-464.0, csgBp, forward] [-464.0, csgBp2, forward]
	ttttctgtcaAGTTATCTGTTTGTTAAgtcaagcaat	[-429.5, ompFp, reverse] [-429.5, ompFp2, reverse]
	acgggtcattGGTAAAGGCAACAAAgagcgtctgg	[-391.5, dsbCp, reverse]
	cctgttacggAatattacatt	[-373.0, ompFp, reverse] [-373.0, ompFp2, reverse]
	taggtgaagaGgcggtttact	[-357.5, dsbCp, reverse]
	tgtgtaaagaAgggtaaaaaa	[-351.0, ompCp1, reverse]
	accgtaaagcGgcgaaaagtg	[-292.0, bacAp, reverse]
	ccgtggacaaTtttttactgc	[-255.0, csgBp, forward] [-255.0, csgBp2, forward]
	tagcaatgcgGTAATGGTTTTCGTCTACcagttcaacg	[-254.0, yidQp, forward]
	tcagtaaattAccgtcagatt	[-223.0, degPp, forward]
	gatttgcgccGCAACTCCCTGAAACGcttccaggaa	[-192.0, ldtDp, forward]
	tattttttatAtgcattatta	[-186.0, csgDp1, reverse] [-186.0, csgDp3, reverse]
	attttttataTGCATTATTAGTAAgttatcacca	[-178.0, csgDp1, reverse] [-178.0, csgDp3, reverse]
	tttctaagtgGTTAAACAAACGGTCAAAtccaatagca	[-176.0, yidQp, forward]
	agtaagttatCaccatttgta	[-166.0, csgDp1, reverse] [-166.0, csgDp3, reverse]
	ccggtaaagaGatcaccatcg	[-165.0, ppiDp2, forward]
	tagcagaacgGTAAAGCGGGGATAAATcaaagttacg	[-143.5, yidQp, forward]
	tttttaaaatTgtgcaataaa	[-141.0, csgDp1, reverse] [-141.0, csgDp3, reverse]
	gtgcttatttCgccattccgc	[-134.0, ompCp1, reverse]
	ttaaaattgtGCAATAAAAACCAAATGtacaactttt	[-129.5, csgDp1, reverse] [-129.5, csgDp3, reverse]
	cagtctatcgCTAACGCGTAGATAAAAtagtttcctg	[-128.5, mdtAp, forward]
	ggagggtgagGAAAGTCAGTTAATGTAATgcctcctact	[-127.5, acrDp2, forward]
	caggtaaagcActgaaagacg	[-117.0, ppiDp2, forward]
	aaatgtacaaCTTTTCTATCATTTCtaaacttaat	[-108.5, csgDp1, reverse] [-108.5, csgDp3, reverse]
	tcggtaaaacCtggtaagtgt	[-101.0, hlpAp, forward]
	tatcatttctAaacttaataa	[-100.0, csgDp1, reverse] [-100.0, csgDp3, reverse]
	tcctactgacCAAAGAATACTTGCacttaaggtt	[-98.0, acrDp2, forward]
	gaaagacgcgGTAAACTAAGCGTTGTCcccagtgggg	[-96.5, ppiDp2, forward]
	ttctatcattTCTAAACTTAATAAAaccttaaggt	[-95.5, csgDp1, reverse] [-95.5, csgDp3, reverse]
	aagttcccttGCATTTACATTTtgaaacatct	[-95.0, ompCp1, reverse]
	aattttacttTtggttacata	[-93.0, ompFp, reverse] [-93.0, ompFp2, reverse]
	caatttacatTtttttgcact	[-81.0, ungp, forward]
	aaaaccttaaGGTTAACATTTTAATataacgagtt	[-73.5, csgDp1, reverse] [-73.5, csgDp3, reverse]
	ccaggcttttGTAAAGACGAACAATAAATttttaccttt	[-71.5, degPp, forward]
	acatatttttTCTTTTTGAAACCAAATctttatcttt	[-68.5, ompFp, reverse] [-68.5, ompFp2, reverse]
	cccctgacgcAtgtttgcagc	[-32.0, cpxPp, forward] [-67.0, cpxRp, reverse] [-67.0, cpxRp2, reverse]
	atgtgcccgtCATTCAGACGATTCCagacagtgtt	[-66.5, mdtAp, forward]
	ggttcagtatAAAAGGGCATGATAATTTacattaactc	[-66.0, acrDp2, forward]
	cgaacaataaAtttttacctt	[-63.0, degPp, forward]
	aatgtaaaaaTatataaactt	[-61.0, ftnBp2, forward]
	ccaacatcatTTTATAAACATTCCGcttgtgtttt	[-54.5, efeUp, forward]
	catctgcaacATTTACAAATTCTTTGCacttccctgc	[-53.5, ldtCp, reverse]
	tgcgtaaagaTgggtaaaact	[-53.0, yccAp, reverse]
	aaaagtgtccGTAACGTGGCGTAAACggcaatgact	[-52.0, sltp7, forward]
	cgagttacatTtagttacatg	[-52.0, csgDp1, reverse] [-52.0, csgDp3, reverse]
	gactttacgtTgttttacacc	[-52.0, cpxPp, forward] [-47.0, cpxRp, reverse] [-47.0, cpxRp2, reverse]
	attgtaatttTtcgtaataat	[-50.0, tomBp, reverse]
	acactttcatTgttttaccgt	[-50.0, spyp, reverse]
	agagtaaaagCttgtaagcgg	[-49.0, srkAp, forward]
	gcctcagcagCGTAAATGAGAGTAAAagcgtaagct	[-48.0, yqaEp, reverse]
	ttacatttagTtacatgttta	[-48.0, csgDp1, reverse] [-48.0, csgDp3, reverse]
	tacgtaaaatTaggtaaaggg	[-47.0, ppiAp1, reverse]
	agtgtcagccTgtgtaaatcc	[-47.0, yqjAp1, forward]
	tcttttgtctCgatatacatt	[-44.0, yebEp, reverse]
	tttagttacaTgtttaacact	[-43.0, csgDp1, reverse] [-43.0, csgDp3, reverse]
	aacttcggatTTCTATGAAAATATTGACgtaattttgc	[-41.0, dgcZp, reverse]
	agtgtaaaacCccgtttacac	[-38.0, aroGp, forward]
	gcagtaaaaaGacgtaaactt	[-37.0, motRp, reverse]
	attcattcatTTGACTTATACTTGCCtgggcaatat	[-29.0, marRp, forward]
	taacacttgaTTTAAGATTTGTAATggctagattg	[-21.5, csgDp1, reverse] [-21.5, csgDp3, reverse]
	cgcgtaaagtAaggtaaataa	[-9.0, tsrp1, forward]
	agcctgaatcGTAAACTCTCTATCGTTGAAtcgcgacaga	[-5.0, cpxPp, forward]
	attgaaatcaGatgtaatcca	[3.0, csgDp1, reverse] [3.0, csgDp3, reverse]
	atcgtaacgcAgcgttaacaa	[8.0, csgBp, forward] [8.0, csgBp2, forward]
	acagcaaaacGccgtaagacc	[11.0, bamEp, forward]
	tgcgttacggAactttacaaa	[67.0, rpoEp1a, reverse]
	caggtaaaaaCgcgtaaaaac	[151.0, psdp, reverse]

High-throughput Transcription factor binding sites (TFBSs)

	Functional conformation	Function	Object name	Object type	Distance to first Gene	Sequence	LeftPos	RightPos	Center Position	Growth Condition	Evidence	Confidence level (C: Confirmed, S: Strong, W: Weak)	References
	CpxR-phosphorylated	activator	yjfN	Transcription-Unit	nd	nd nd	nd	nd	nd	nd	[EXP-IEP-GENE-EXPRESSION-ANALYSIS], [COMP-HINF-SIMILAR-TO-CONSENSUS]	W	[7]

Alignment and PSSM for CpxR TFBSs

Aligned TFBS of CpxR

	Sequence
	TTTACGTTGTTTTACACCCC
	TTTACGTCTTTTTACTGCCC
	TTTACCCATCTTTACGCATT
	TTTTCGCCGCTTTACGGTTA
	TTTACCCTTCTTTACACACT
	CTTTCATTGTTTTACCGTTG
	TTTACATTTTTTTGCACTCG
	CTTACCAGGTTTTACCGATG
	TTTACGCCACGTTACGGACA
	TTTACCTTACTTTACGCGCG
	TTTACCTAATTTTACGTATC
	TTTACGCGTTTTTACCTGCG
	CTTACGGCGTTTTGCTGTTT
	TTATCCCCGCTTTACCGTTC
	TTTACTTTTGGTTACATATT
	CTTACAAGCTTTTACTCTTT
	TTTATATATTTTTACATTTC
	CTTTCAGTGCTTTACCTGCA
	TTAACGCTGCGTTACGATGG
	TTTACACAGGCTGACACTTT
	CTGACGGTAATTTACTGACA
	CTGACGCATGTTTGCAGCCT
	TTTACTCTCATTTACGCTGC
	GTTACGGAACTTTACAAAAA
	TGGACAATTTTTTACTGCAA
	TAAACGGGGTTTTACACTAT
	ATTACGAAAAATTACAATTA
	TTTACAAATTCTTTGCACTT
	TTATCTACGCGTTAGCGATA
	GTTACGGAATATTACATTGC
	ATTACATCTGATTTCAATCT
	CTTTGTTGCCTTTACCAATG
	TGTACATTTGGTTTTTATTG
	TGGTGATCTCTTTACCGGTC
	TTTTATTAAGTTTAGAAATG
	TTTTCTTTTTGAAACCAAAT
	TTGACCGTTTGTTTAACCAC
	ATTACATTAACTGACTTTCC
	TTGACTTATACTTGCCTGGG
	TTTAAGATTTGTAATGGCTA
	TTTTATAAACATTCCGCTTG
	GTTTCAGGGAGTTGCGGCGC
	TGTAAATTATCATGCCCTTT
	CTTTTGTCTCGATATACATT
	CGATAGAGAGTTTACGATTC
	CTTTTCTATCATTTCTAAAC
	TTATCTGTTTGTTAAGTCAA
	CTTATTTCGCCATTCCGCAA
	ATTGTTCGTCTTTACAAAAG
	TAAACTAAGCGTTGTCCCCA
	CTGACCAAAGAATACTTGCA
	AGTTACATGTTTAACACTTG
	ATTACGTCAATATTTTCATA
	CATACAAATGGTGATAACTT
	TATTAAAATGTTAACCTTAA
	TATATGCATTATTAGTAAGT
	CGGTAATGGTTTTCGTCTAC
	CTTGCATTTACATTTTGAAA
	CTGGAATCGTCTGAATGACG
	TAAACCGCCTCTTCACCTAA

Position weight matrix (PWM). CpxR matrix-quality result

A	6	6	8	39	9	19	14	18	14	8	7	7	4	42	4	18	14	19	13	17
C	17	0	0	0	43	11	12	13	4	18	9	0	0	3	44	16	18	12	15	14
G	3	7	9	3	2	18	10	9	17	10	13	0	4	7	5	12	17	6	6	14
T	34	47	43	18	6	12	24	20	25	24	31	53	52	8	7	14	11	23	26	15

Consensus

;	consensus.strict             	tttaCgtttctTTaCccttg
;	consensus.strict.rc          	CAAGGGTAAAGAAACGTAAA
;	consensus.IUPAC              	yttwCrthkykTTaCmswys
;	consensus.IUPAC.rc           	SRWSKGTAAMRMDAYGWAAR
;	consensus.regexp             	[ct]tt[at]C[ag]t[act][gt][ct][gt]TTaC[ac][cg][at][ct][cg]
;	consensus.regexp.rc          	[CG][AG][AT][CG][GT]GTAA[AC][AG][AC][AGT]A[CT]G[AT]AA[AG]

PWM logo

Evolutionary conservation of regulatory elements

Note: Evolutionary conservation of regulatory interactions and promoters is limited to gammaproteobacteria.

TF-target gene evolutionary conservation
Promoter-target gene evolutionary conservation

Evidence
[EXP-IDA-BINDING-OF-PURIFIED-PROTEINS] Binding of purified proteins
[EXP-IPI] Inferred from physical interaction
[EXP-IEP-GENE-EXPRESSION-ANALYSIS] Gene expression analysis
[IC] Inferred by curator
[COMP-HINF-SIMILAR-TO-CONSENSUS] A person inferred or reviewed a computer inference of sequence function based on similarity to a consensus sequence.
[COMP] Inferred by computational analysis
[EXP-CHIP-EXO] high throughput ChIP-exo evidence
[COMP-AINF-SIMILAR-TO-CONSENSUS] Automated inference based on similarity to consensus sequences
[EXP-IMP-SITE-MUTATION] Site mutation
[EXP-IGI] Inferred from genetic interaction
[EXP-IDA-BINDING-OF-CELLULAR-EXTRACTS] Binding of cellular extracts

Reference(s)
[1] Pogliano J., Lynch AS., Belin D., Lin EC., Beckwith J., 1997, Regulation of Escherichia coli cell envelope proteins involved in protein folding and degradation by the Cpx two-component system., Genes Dev 11(9):1169-82
[2] Yamamoto K., Hirao K., Oshima T., Aiba H., Utsumi R., Ishihama A., 2005, Functional characterization in vitro of all two-component signal transduction systems from Escherichia coli., J Biol Chem 280(2):1448-56
[3] Yamamoto K., Ishihama A., 2006, Characterization of copper-inducible promoters regulated by CpxA/CpxR in Escherichia coli., Biosci Biotechnol Biochem 70(7):1688-95
[4] Hirakawa H., Inazumi Y., Masaki T., Hirata T., Yamaguchi A., 2005, Indole induces the expression of multidrug exporter genes in Escherichia coli., Mol Microbiol 55(4):1113-26
[5] De Wulf P., McGuire AM., Liu X., Lin EC., 2002, Genome-wide profiling of promoter recognition by the two-component response regulator CpxR-P in Escherichia coli., J Biol Chem 277(29):26652-61
[6] De Wulf P., Kwon O., Lin EC., 1999, The CpxRA signal transduction system of Escherichia coli: growth-related autoactivation and control of unanticipated target operons., J Bacteriol 181(21):6772-8
[7] Raivio TL., Leblanc SK., Price NL., 2013, The Escherichia coli Cpx envelope stress response regulates genes of diverse function that impact antibiotic resistance and membrane integrity., J Bacteriol 195(12):2755-67
[8] Choudhary KS, Kleinmanns JA, Decker K, Sastry AV, Gao Y, Szubin R, Seif Y, Palsson BO, 2020, Elucidation of Regulatory Modes for Five Two-Component Systems in Escherichia coli Reveals Novel Relationships., mSystems, 5(6):None 10.1128/mSystems.00980-20
[9] Prigent-Combaret C., Brombacher E., Vidal O., Ambert A., Lejeune P., Landini P., Dorel C., 2001, Complex regulatory network controls initial adhesion and biofilm formation in Escherichia coli via regulation of the csgD gene., J Bacteriol 183(24):7213-23
[10] Ogasawara H., Yamada K., Kori A., Yamamoto K., Ishihama A., 2010, Regulation of the Escherichia coli csgD promoter: interplay between five transcription factors., Microbiology 156(Pt 8):2470-83
[11] Jubelin G., Vianney A., Beloin C., Ghigo JM., Lazzaroni JC., Lejeune P., Dorel C., 2005, CpxR/OmpR interplay regulates curli gene expression in response to osmolarity in Escherichia coli., J Bacteriol 187(6):2038-49
[12] Vogt SL., Evans AD., Guest RL., Raivio TL., 2014, The Cpx envelope stress response regulates and is regulated by small noncoding RNAs., J Bacteriol 196(24):4229-38
[13] Danese PN., Snyder WB., Cosma CL., Davis LJ., Silhavy TJ., 1995, The Cpx two-component signal transduction pathway of Escherichia coli regulates transcription of the gene specifying the stress-inducible periplasmic protease, DegP., Genes Dev 9(4):387-98
[14] Dartigalongue C., Missiakas D., Raina S., 2001, Characterization of the Escherichia coli sigma E regulon., J Biol Chem 276(24):20866-75
[15] Bernal-Cabas M., Ayala JA., Raivio TL., 2015, The Cpx Envelope Stress Response Modifies Peptidoglycan Cross-Linking via the l,d-Transpeptidase LdtD and the Novel Protein YgaU., J Bacteriol 197(3):603-14
[16] Weatherspoon-Griffin N., Yang D., Kong W., Hua Z., Shi Y., 2014, The CpxR/CpxA two-component regulatory system up-regulates the multidrug resistance cascade to facilitate Escherichia coli resistance to a model antimicrobial peptide., J Biol Chem 289(47):32571-82
[17] Batchelor E., Walthers D., Kenney LJ., Goulian M., 2005, The Escherichia coli CpxA-CpxR envelope stress response system regulates expression of the porins ompF and ompC., J Bacteriol 187(16):5723-31
[18] Oshima T., Aiba H., Masuda Y., Kanaya S., Sugiura M., Wanner BL., Mori H., Mizuno T., 2002, Transcriptome analysis of all two-component regulatory system mutants of Escherichia coli K-12., Mol Microbiol 46(1):281-91
[19] Dartigalongue C., Raina S., 1998, A new heat-shock gene, ppiD, encodes a peptidyl-prolyl isomerase required for folding of outer membrane proteins in Escherichia coli., EMBO J 17(14):3968-80
[20] Zahrl D., Wagner M., Bischof K., Koraimann G., 2006, Expression and assembly of a functional type IV secretion system elicit extracytoplasmic and cytoplasmic stress responses in Escherichia coli., J Bacteriol 188(18):6611-21
[21] Raffa RG., Raivio TL., 2002, A third envelope stress signal transduction pathway in Escherichia coli., Mol Microbiol 45(6):1599-611
[22] Raivio TL., Laird MW., Joly JC., Silhavy TJ., 2000, Tethering of CpxP to the inner membrane prevents spheroplast induction of the cpx envelope stress response., Mol Microbiol 37(5):1186-97
[23] Danese PN., Silhavy TJ., 1997, The sigma(E) and the Cpx signal transduction systems control the synthesis of periplasmic protein-folding enzymes in Escherichia coli., Genes Dev 11(9):1183-93
[24] Ogasawara H., Teramoto J., Hirao K., Yamamoto K., Ishihama A., Utsumi R., 2004, Negative regulation of DNA repair gene (ung) expression by the CpxR/CpxA two-component system in Escherichia coli K-12 and induction of mutations by increased expression of CpxR., J Bacteriol 186(24):8317-25
[25] McEwen J, Silverman P, 1980, Genetic analysis of Escherichia coli K-12 chromosomal mutants defective in expression of F-plasmid functions: identification of genes cpxA and cpxB., J Bacteriol, 144(1):60 10.1128/jb.144.1.60-67.1980
[26] Lau-Wong IC, Locke T, Ellison MJ, Raivio TL, Frost LS, 2008, Activation of the Cpx regulon destabilizes the F plasmid transfer activator, TraJ, via the HslVU protease in Escherichia coli., Mol Microbiol, 67(3):516 10.1111/j.1365-2958.2007.06055.x
[27] Dorel C., Lejeune P., Rodrigue A., 2006, The Cpx system of Escherichia coli, a strategic signaling pathway for confronting adverse conditions and for settling biofilm communities?, Res Microbiol 157(4):306-14
[28] Raivio TL, 2005, Envelope stress responses and Gram-negative bacterial pathogenesis., Mol Microbiol, 56(5):1119 10.1111/j.1365-2958.2005.04625.x
[29] Guharajan S, Chhabra S, Parisutham V, Brewster RC, 2021, Quantifying the regulatory role of individual transcription factors in Escherichia coli., Cell Rep, 37(6):109952 10.1016/j.celrep.2021.109952
[30] Dong J., Iuchi S., Kwan HS., Lu Z., Lin EC., 1993, The deduced amino-acid sequence of the cloned cpxR gene suggests the protein is the cognate regulator for the membrane sensor, CpxA, in a two-component signal transduction system of Escherichia coli., Gene 136(1-2):227-30
[31] Snyder WB, Davis LJ, Danese PN, Cosma CL, Silhavy TJ, 1995, Overproduction of NlpE, a new outer membrane lipoprotein, suppresses the toxicity of periplasmic LacZ by activation of the Cpx signal transduction pathway., J Bacteriol, 177(15):4216 10.1128/jb.177.15.4216-4223.1995
[32] Otto K, Silhavy TJ, 2002, Surface sensing and adhesion of Escherichia coli controlled by the Cpx-signaling pathway., Proc Natl Acad Sci U S A, 99(4):2287 10.1073/pnas.042521699
[33] Gupta SD., Lee BT., Camakaris J., Wu HC., 1995, Identification of cutC and cutF (nlpE) genes involved in copper tolerance in Escherichia coli., J Bacteriol 177(15):4207-15
[34] Delhaye A., Laloux G., Collet JF., 2019, The Lipoprotein NlpE Is a Cpx Sensor That Serves as a Sentinel for Protein Sorting and Folding Defects in the Escherichia coli Envelope., J Bacteriol 201(10)
[35] Fleischer R, Heermann R, Jung K, Hunke S, 2007, Purification, reconstitution, and characterization of the CpxRAP envelope stress system of Escherichia coli., J Biol Chem, 282(12):8583 10.1074/jbc.M605785200
[36] Buelow DR, Raivio TL, 2005, Cpx signal transduction is influenced by a conserved N-terminal domain in the novel inhibitor CpxP and the periplasmic protease DegP., J Bacteriol, 187(19):6622 10.1128/JB.187.19.6622-6630.2005
[37] Isaac DD, Pinkner JS, Hultgren SJ, Silhavy TJ, 2005, The extracytoplasmic adaptor protein CpxP is degraded with substrate by DegP., Proc Natl Acad Sci U S A, 102(49):17775 10.1073/pnas.0508936102
[38] Raivio TL, Silhavy TJ, 1997, Transduction of envelope stress in Escherichia coli by the Cpx two-component system., J Bacteriol, 179(24):7724 10.1128/jb.179.24.7724-7733.1997
[39] Wolfe AJ, Parikh N, Lima BP, Zemaitaitis B, 2008, Signal integration by the two-component signal transduction response regulator CpxR., J Bacteriol, 190(7):2314 10.1128/JB.01906-07
[40] Lima BP, Thanh Huyen TT, Bäsell K, Becher D, Antelmann H, Wolfe AJ, 2012, Inhibition of acetyl phosphate-dependent transcription by an acetylatable lysine on RNA polymerase., J Biol Chem, 287(38):32147 10.1074/jbc.M112.365502
[41] Lima BP, Lennon CW, Ross W, Gourse RL, Wolfe AJ, 2016, In vitro evidence that RNA Polymerase acetylation and acetyl phosphate-dependent CpxR phosphorylation affect cpxP transcription regulation., FEMS Microbiol Lett, 363(5):fnw011 10.1093/femsle/fnw011
[42] Vazquez-Ciros OJ., Alvarez AF., Georgellis D., 2020, Identification of Z nucleotides as an ancient signal for two-component system activation in bacteria., Proc Natl Acad Sci U S A 117(52):33530-33539
[43] Itou H, Tanaka I, 2001, The OmpR-family of proteins: insight into the tertiary structure and functions of two-component regulator proteins., J Biochem, 129(3):343 10.1093/oxfordjournals.jbchem.a002863
[44] Bachhawat P, Stock AM, 2007, Crystal structures of the receiver domain of the response regulator PhoP from Escherichia coli in the absence and presence of the phosphoryl analog beryllofluoride., J Bacteriol, 189(16):5987 10.1128/JB.00049-07
[45] Mechaly AE, Sassoon N, Betton JM, Alzari PM, 2014, Segmental helical motions and dynamical asymmetry modulate histidine kinase autophosphorylation., PLoS Biol, 12(1):e1001776 10.1371/journal.pbio.1001776
[46] Mechaly AE, Soto Diaz S, Sassoon N, Buschiazzo A, Betton JM, Alzari PM, 2017, Structural Coupling between Autokinase and Phosphotransferase Reactions in a Bacterial Histidine Kinase., Structure, 25(6):939 10.1016/j.str.2017.04.011
[47] Mechaly AE, Haouz A, Sassoon N, Buschiazzo A, Betton JM, Alzari PM, 2018, Conformational plasticity of the response regulator CpxR, a key player in Gammaproteobacteria virulence and drug-resistance., J Struct Biol, 204(2):165 10.1016/j.jsb.2018.08.001
[48] Raivio TL, Silhavy TJ, 1999, The sigmaE and Cpx regulatory pathways: overlapping but distinct envelope stress responses., Curr Opin Microbiol, 2(2):159 10.1016/S1369-5274(99)80028-9
[49] Nie T, Zhang C, Huang A, Li P, 2018, Epigallocatechin Gallate-Mediated Cell Death Is Triggered by Accumulation of Reactive Oxygen Species Induced via the Cpx Two-Component System in Escherichia coli., Front Microbiol, 9(None):246 10.3389/fmicb.2018.00246
[50] Miyake Y., Yamamoto K., 2020, Epistatic Effect of Regulators to the Adaptive Growth of Escherichia coli., Sci Rep 10(1):3661

RegulonDB