RegulonDB

Regulon
Regulated gene(s)	araA, araB, araC, araD, araE, araF, araG, araH, araJ, xylA, xylB, ydeM, ydeN, ygeA
Multifun term(s) of regulated gene(s)	MultiFun Term (List of genes associated to the multifun term) carbon compounds (11) araA, araB, araC, araD, araE, araF, araG, araH, araJ, xylA, xylB membrane (3) araE, araH, araJ Porters (Uni-, Sym- and Antiporters) (2) araE, araJ Transcription related (1) araC activator (1) araC repressor (1) araC operon (1) araC ABC superfamily, periplasmic binding component (1) araF ABC superfamily ATP binding cytoplasmic component (1) araG ABC superfamily, membrane component (1) araH chaperoning, repair (refolding) (1) ydeM sulfur metabolism (1) ydeN Read more >
Regulated operon(s)	araBAD, araC, araE-ygeA, araFGH, araJ, xylAB, ydeNM
First gene in the operon(s)	araB, araC, araE, araF, araJ, xylA, ydeN
Simple and complex regulons	AraC,CRP AraC,CRP,XylR AraC,GadX,NagC
Simple and complex regulatory phrases	Regulatory phrase (List of promoters regulated by the phrase) [AraC,-](4) araBp, araCp, xylAp, ydeNp [AraC,+](6) araBp, araCp, araEp, araFp1, araFp3, araJp

Transcription factor binding sites (TFBSs) arrangements

Functional conformation	Function	Promoter	Sigma factor	Central Rel-Pos	Distance to first Gene	Genes	Sequence	LeftPos	RightPos	Evidence	Confidence level (C: Confirmed, S: Strong, W: Weak)	References
AraC	repressor	araBp	Sigma70	-275.0	-302.0	araB, araA, araD	attcagagaaGAAACCAATTGTCCATAttgcatcaga attcagagaaGAAACCAATTGTCCATAttgcatcaga	70342	70358	[COMP-HINF-SIMILAR-TO-CONSENSUS], [EXP-IDA-BINDING-OF-CELLULAR-EXTRACTS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS], [EXP-IMP-SITE-MUTATION]	C	[2], [6], [6], [7], [8], [8], [9], [10], [11]
AraC-α-L-arabinopyranose	repressor	araBp	Sigma70	-138.0	-165.0	araB, araA, araD	caaaaacgcgTAACAAAAGTGTCTATAatcacggcag caaaaacgcgTAACAAAAGTGTCTATAatcacggcag	70205	70221	[EXP-IEP-GENE-EXPRESSION-ANALYSIS], [COMP-HINF-SIMILAR-TO-CONSENSUS], [EXP-IDA-BINDING-OF-CELLULAR-EXTRACTS], [EXP-IMP-SITE-MUTATION]	C	[4], [4], [9], [11]
AraC-α-L-arabinopyranose	repressor	araBp	Sigma70	-117.0	-144.0	araB, araA, araD	tctataatcaCGGCAGAAAAGTCCACAttgattattt tctataatcaCGGCAGAAAAGTCCACAttgattattt	70184	70200	[EXP-IEP-GENE-EXPRESSION-ANALYSIS], [COMP-HINF-SIMILAR-TO-CONSENSUS], [EXP-IDA-BINDING-OF-CELLULAR-EXTRACTS], [EXP-IMP-SITE-MUTATION]	C	[4], [4], [9], [11]
AraC	repressor	araBp	Sigma70	-64.0	-91.0	araB, araA, araD	tgctatgccaTAGCATTTTTATCCATAagattagcgg tgctatgccaTAGCATTTTTATCCATAagattagcgg	70131	70147	[EXP-IEP-GENE-EXPRESSION-ANALYSIS], [COMP-HINF-SIMILAR-TO-CONSENSUS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS], [EXP-IMP-SITE-MUTATION]	C	[1], [1], [6], [7], [8], [8], [9], [10], [11], [12]
AraC-α-L-arabinopyranose	activator	araBp	Sigma70	-64.0	-91.0	araB, araA, araD	tgctatgccaTAGCATTTTTATCCATAagattagcgg tgctatgccaTAGCATTTTTATCCATAagattagcgg	70131	70147	[EXP-IEP-GENE-EXPRESSION-ANALYSIS], [COMP-HINF-SIMILAR-TO-CONSENSUS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS], [EXP-IMP-SITE-MUTATION]	C	[1], [1], [6], [7], [8], [8], [9], [10], [11], [12]
AraC-α-L-arabinopyranose	activator	araBp	Sigma70	-43.0	-70.0	araB, araA, araD	tccataagatTAGCGGATCCTACCTGAcgctttttat tccataagatTAGCGGATCCTACCTGAcgctttttat	70110	70126	[EXP-IEP-GENE-EXPRESSION-ANALYSIS], [COMP-HINF-SIMILAR-TO-CONSENSUS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS], [EXP-IMP-SITE-MUTATION]	C	[1], [1], [2], [5], [6], [7], [8], [8], [9], [12]
AraC-α-L-arabinopyranose	activator	araCp	Sigma70	-105.0	-269.0	araC	ataaaaagcgTCAGGTAGGATCCGCTAatcttatgga tccataagatTAGCGGATCCTACCTGAcgctttttat	70110	70126	[EXP-IEP-GENE-EXPRESSION-ANALYSIS], [COMP-HINF-SIMILAR-TO-CONSENSUS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS], [EXP-IMP-SITE-MUTATION]	C	[1], [2], [2], [5], [8], [8], [9], [12]
AraC	repressor	araCp	Sigma70	-84.0	-248.0	araC	ccgctaatctTATGGATAAAAATGCTAtggcatagca tgctatgccaTAGCATTTTTATCCATAagattagcgg	70131	70147	[EXP-IEP-GENE-EXPRESSION-ANALYSIS], [COMP-HINF-SIMILAR-TO-CONSENSUS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS], [EXP-IMP-SITE-MUTATION]	C	[1], [8], [8], [9], [10], [11], [12]
AraC-α-L-arabinopyranose	activator	araCp	Sigma70	-84.0	-248.0	araC	ccgctaatctTATGGATAAAAATGCTAtggcatagca tgctatgccaTAGCATTTTTATCCATAagattagcgg	70131	70147	[EXP-IEP-GENE-EXPRESSION-ANALYSIS], [COMP-HINF-SIMILAR-TO-CONSENSUS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS], [EXP-IMP-SITE-MUTATION]	C	[1], [8], [8], [9], [10], [11], [12]
AraC-α-L-arabinopyranose	repressor	araCp	Sigma70	-31.0	-195.0	araC	aaataatcaaTGTGGACTTTTCTGCCGtgattataga tctataatcaCGGCAGAAAAGTCCACAttgattattt	70184	70200	[EXP-IEP-GENE-EXPRESSION-ANALYSIS], [COMP-HINF-SIMILAR-TO-CONSENSUS], [EXP-IDA-BINDING-OF-CELLULAR-EXTRACTS], [EXP-IMP-SITE-MUTATION]	C	[4], [4], [9], [11]
AraC-α-L-arabinopyranose	repressor	araCp	Sigma70	-10.0	-174.0	araC	ctgccgtgatTATAGACACTTTTGTTAcgcgtttttg caaaaacgcgTAACAAAAGTGTCTATAatcacggcag	70205	70221	[EXP-IEP-GENE-EXPRESSION-ANALYSIS], [COMP-HINF-SIMILAR-TO-CONSENSUS], [EXP-IDA-BINDING-OF-CELLULAR-EXTRACTS], [EXP-IMP-SITE-MUTATION]	C	[4], [4], [9], [9], [11]
AraC	repressor	araCp	Sigma70	128.0	-37.0	araC	tctgatgcaaTATGGACAATTGGTTTCttctctgaat attcagagaaGAAACCAATTGTCCATAttgcatcaga	70342	70358	[COMP-HINF-SIMILAR-TO-CONSENSUS], [EXP-IDA-BINDING-OF-CELLULAR-EXTRACTS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS], [EXP-IMP-SITE-MUTATION]	C	[2], [6], [8], [9], [10], [11]
AraC-α-L-arabinopyranose	activator	araEp	Sigma70	-65.0	-91.0	araE, ygeA	cgacatgtcgCAGCAATTTAATCCATAtttatgctgt cgacatgtcgCAGCAATTTAATCCATAtttatgctgt	2982265	2982281	[COMP-HINF-SIMILAR-TO-CONSENSUS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS]	S	[9], [13], [13]
AraC-α-L-arabinopyranose	activator	araEp	Sigma70	-44.0	-70.0	araE, ygeA	tccatatttaTGCTGTTTCCGACCTGAcacctgcgtg tccatatttaTGCTGTTTCCGACCTGAcacctgcgtg	2982244	2982260	[COMP-HINF-SIMILAR-TO-CONSENSUS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS]	S	[9], [13], [13]
AraC-α-L-arabinopyranose	activator	araFp1	Sigma70	-166.0	-276.0	araF, araG, araH	ccaaagacaaCAAGGATTTCCAGGCTAatcttatgga tccataagatTAGCCTGGAAATCCTTGttgtctttgg	1986396	1986412	[EXP-IDA-BINDING-OF-PURIFIED-PROTEINS], [EXP-IMP-SITE-MUTATION]	C	[9], [14], [14], [15], [15]
AraC-α-L-arabinopyranose	activator	araFp1	Sigma70	-145.0	-255.0	araF, araG, araH	aggctaatctTATGGATTAATCTGCTGtgcattcgac gtcgaatgcaCAGCAGATTAATCCATAagattagcct	1986375	1986391	[COMP-AINF-SIMILAR-TO-CONSENSUS], [COMP-HINF-SIMILAR-TO-CONSENSUS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS]	S	[3], [9], [14], [14], [15], [15]
AraC-α-L-arabinopyranose	activator	araFp1	Sigma70	-91.0	-201.0	araF, araG, araH	ggctttccctTATGTCTTTTCCCGCTAaatttatgca tgcataaattTAGCGGGAAAAGACATAagggaaagcc	1986321	1986337	[EXP-IDA-BINDING-OF-PURIFIED-PROTEINS], [EXP-IMP-SITE-MUTATION]	C	[9], [14], [14], [15], [15]
AraC-α-L-arabinopyranose	activator	araFp1	Sigma70	-70.0	-180.0	araF, araG, araH	ccgctaaattTATGCACGTTCTCACTGtaattctgcg cgcagaattaCAGTGAGAACGTGCATAaatttagcgg	1986300	1986316	[COMP-HINF-SIMILAR-TO-CONSENSUS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS]	S	[3], [14], [14], [15], [15], [16]
AraC-α-L-arabinopyranose	activator	araFp3	Sigma38	-166.0	-276.0	araF, araG, araH	ccaaagacaaCAAGGATTTCCAGGCTAatcttatgga nd	1986396	1986412	[EXP-IDA-BINDING-OF-PURIFIED-PROTEINS], [EXP-IMP-SITE-MUTATION]	C	[9], [14], [14], [15], [15]
AraC-α-L-arabinopyranose	activator	araFp3	Sigma38	-145.0	-255.0	araF, araG, araH	aggctaatctTATGGATTAATCTGCTGtgcattcgac nd	1986375	1986391	[COMP-AINF-SIMILAR-TO-CONSENSUS], [COMP-HINF-SIMILAR-TO-CONSENSUS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS]	S	[3], [9], [14], [14], [15], [15]
AraC-α-L-arabinopyranose	activator	araFp3	Sigma38	-91.0	-201.0	araF, araG, araH	ggctttccctTATGTCTTTTCCCGCTAaatttatgca nd	1986321	1986337	[EXP-IDA-BINDING-OF-PURIFIED-PROTEINS], [EXP-IMP-SITE-MUTATION]	C	[9], [14], [14], [15], [15]
AraC-α-L-arabinopyranose	activator	araFp3	Sigma38	-70.0	-180.0	araF, araG, araH	ccgctaaattTATGCACGTTCTCACTGtaattctgcg nd	1986300	1986316	[COMP-HINF-SIMILAR-TO-CONSENSUS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS]	S	[3], [14], [14], [15], [15], [16]
AraC-α-L-arabinopyranose	activator	araJp	Sigma70	-64.0	-112.0	araJ	aataactattCAGCAGGATAATGAATAcagaggggcg aataactattCAGCAGGATAATGAATAcagaggggcg	412585	412601	[COMP-HINF-SIMILAR-TO-CONSENSUS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS]	S	[9], [14], [14], [17]
AraC-α-L-arabinopyranose	activator	araJp	Sigma70	-43.0	-91.0	araJ	tgaatacagaGGGGCGAATTATCTCTTggccttgctg tgaatacagaGGGGCGAATTATCTCTTggccttgctg	412564	412580	[COMP-AINF-SIMILAR-TO-CONSENSUS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS]	S	[9], [14], [14], [17]
AraC-α-L-arabinopyranose	repressor	xylAp	nd	-48.0	-90.0	xylA, xylB	attatctcaaTAGCAGTGTGAAATAACataattgagc attatctcaaTAGCAGTGTGAAATAACataattgagc	3730847	3730863	[EXP-IEP-GENE-EXPRESSION-ANALYSIS], [COMP-HINF-SIMILAR-TO-CONSENSUS], [EXP-IDA-BINDING-OF-CELLULAR-EXTRACTS]	S	[18], [18]
AraC-α-L-arabinopyranose	repressor	xylAp	nd	-25.0	-67.0	xylA, xylB	taacataattGAGCAACTGAAAGGGAGtgcccaatat taacataattGAGCAACTGAAAGGGAGtgcccaatat	3730824	3730840	[EXP-IEP-GENE-EXPRESSION-ANALYSIS], [EXP-IDA-BINDING-OF-CELLULAR-EXTRACTS]	W	[18], [18]
AraC-α-L-arabinopyranose	repressor	ydeNp	Sigma70	nd	nd	ydeN, ydeM	nd nd	nd	nd	[EXP-IEP-GENE-EXPRESSION-ANALYSIS]	W	[19]

	Sequence
	tctgatgcaaTATGGACAATTGGTTTCttctctgaat	[-275.0, araBp, reverse] [128.0, araCp, forward]
	ccaaagacaaCAAGGATTTCCAGGCTAatcttatgga	[-166.0, araFp1, reverse] [-166.0, araFp3, reverse]
	aggctaatctTATGGATTAATCTGCTGtgcattcgac	[-145.0, araFp1, reverse] [-145.0, araFp3, reverse]
	ctgccgtgatTATAGACACTTTTGTTAcgcgtttttg	[-138.0, araBp, reverse] [-10.0, araCp, forward]
	aaataatcaaTGTGGACTTTTCTGCCGtgattataga	[-117.0, araBp, reverse] [-31.0, araCp, forward]
	ataaaaagcgTCAGGTAGGATCCGCTAatcttatgga	[-43.0, araBp, reverse] [-105.0, araCp, forward]
	ggctttccctTATGTCTTTTCCCGCTAaatttatgca	[-91.0, araFp1, reverse] [-91.0, araFp3, reverse]
	ccgctaatctTATGGATAAAAATGCTAtggcatagca	[-64.0, araBp, reverse] [-84.0, araCp, forward]
	ccgctaaattTATGCACGTTCTCACTGtaattctgcg	[-70.0, araFp1, reverse] [-70.0, araFp3, reverse]
	cgacatgtcgCAGCAATTTAATCCATAtttatgctgt	[-65.0, araEp, reverse]
	aataactattCAGCAGGATAATGAATAcagaggggcg	[-64.0, araJp, reverse]
	attatctcaaTAGCAGTGTGAAATAACataattgagc	[-48.0, xylAp, reverse]
	tccatatttaTGCTGTTTCCGACCTGAcacctgcgtg	[-44.0, araEp, reverse]
	tgaatacagaGGGGCGAATTATCTCTTggccttgctg	[-43.0, araJp, reverse]
	taacataattGAGCAACTGAAAGGGAGtgcccaatat	[-25.0, xylAp, reverse]

High-throughput Transcription factor binding sites (TFBSs)

	Functional conformation	Function	Object name	Object type	Distance to first Gene	Sequence	LeftPos	RightPos	Center Position	Growth Condition	Evidence	Confidence level (C: Confirmed, S: Strong, W: Weak)	References
	AraC	repressor	ytfQRT-yjfF	Transcription-Unit	nd	agacggtataCAGAGCAGGAAAATCCATAAccgtagccgc nd	4449772	4449791	4449781.0	nd	[EXP-IEP-GENE-EXPRESSION-ANALYSIS], [COMP-AINF-SIMILAR-TO-CONSENSUS], [EXP-IMP-SITE-MUTATION]	W	[19]

Alignment and PSSM for AraC TFBSs

Aligned TFBS of AraC

	Sequence
	CACAGCAGATTAATCCATAA
	CGCAGCAATTTAATCCATAT
	TACAGTGAGAACGTGCATAA
	CATAGCATTTTTATCCATAA
	CACGGCAGAAAAGTCCACAT
	TTTAGCGGGAAAAGACATAA
	TTCAGCAGGATAATGAATAC
	AGCAGTGTGAAATAACATAA
	AAGAAACCAATTGTCCATAT
	CGTAACAAAAGTGTCTATAA
	ATTAGCCTGGAAATCCTTGT
	TCAGGTCGGAAACAGCATAA
	GATTAGCGGATCCTACCTGA
	AAGAGATAATTCGCCCCTCT
	CCCTTTCAGTTGCTCAATTA

Position weight matrix (PWM). AraC matrix-quality result

A	4	7	1	11	3	2	6	5	5	9	6	8	6	2	3	2	12	0	11	9
C	6	2	7	0	0	8	5	1	0	0	0	3	3	1	9	12	2	1	1	1
G	1	3	2	2	11	1	3	6	8	1	1	1	5	1	3	0	0	0	2	0
T	4	3	5	2	1	4	1	3	2	5	8	3	1	11	0	1	1	14	1	5

Consensus

;	consensus.strict             	cacaGccggatagtCCaTaa
;	consensus.strict.rc          	TTATGGACTATCCGGCTGTG
;	consensus.IUPAC              	cayaGcmrrwwartCCaTaw
;	consensus.IUPAC.rc           	WTATGGAYTWWYYKGCTRTG
;	consensus.regexp             	ca[ct]aGc[ac][ag][ag][at][at]a[ag]tCCaTa[at]
;	consensus.regexp.rc          	[AT]TATGGA[CT]T[AT][AT][CT][CT][GT]GCT[AG]TG

PWM logo

Evolutionary conservation of regulatory elements

Note: Evolutionary conservation of regulatory interactions and promoters is limited to gammaproteobacteria.

TF-target gene evolutionary conservation
Promoter-target gene evolutionary conservation

Evidence
[EXP-IDA] Inferred from direct assay
[EXP-IDA-BINDING-OF-PURIFIED-PROTEINS] Binding of purified proteins
[EXP-IMP-SITE-MUTATION] Site mutation
[COMP-HINF-SIMILAR-TO-CONSENSUS] A person inferred or reviewed a computer inference of sequence function based on similarity to a consensus sequence.
[EXP-IDA-BINDING-OF-CELLULAR-EXTRACTS] Binding of cellular extracts
[EXP-IEP-GENE-EXPRESSION-ANALYSIS] Gene expression analysis
[COMP-AINF-SIMILAR-TO-CONSENSUS] Automated inference based on similarity to consensus sequences

Reference(s)
[1] Bustos SA., Schleif RF., 1993, Functional domains of the AraC protein., Proc Natl Acad Sci U S A 90(12):5638-42
[2] Huo L., Martin KJ., Schleif R., 1988, Alternative DNA loops regulate the arabinose operon in Escherichia coli., Proc Natl Acad Sci U S A 85(15):5444-8
[3] Johnson CM., Schleif RF., 1995, In vivo induction kinetics of the arabinose promoters in Escherichia coli., J Bacteriol 177(12):3438-42
[4] Lee DH., Huo L., Schleif R., 1992, Repression of the araBAD promoter from araO1., J Mol Biol 224(2):335-41
[5] Lee N., Francklyn C., Hamilton EP., 1987, Arabinose-induced binding of AraC protein to araI2 activates the araBAD operon promoter., Proc Natl Acad Sci U S A 84(24):8814-8
[6] Seabold RR., Schleif RF., 1998, Apo-AraC actively seeks to loop., J Mol Biol 278(3):529-38
[7] Lobell RB., Schleif RF., 1991, AraC-DNA looping: orientation and distance-dependent loop breaking by the cyclic AMP receptor protein., J Mol Biol 218(1):45-54
[8] Niland P., Huhne R., Muller-Hill B., 1996, How AraC interacts specifically with its target DNAs., J Mol Biol 264(4):667-74
[9] Gallegos MT., Schleif R., Bairoch A., Hofmann K., Ramos JL., 1997, Arac/XylS family of transcriptional regulators., Microbiol Mol Biol Rev 61(4):393-410
[10] Lee DH., Schleif RF., 1989, In vivo DNA loops in araCBAD: size limits and helical repeat., Proc Natl Acad Sci U S A 86(2):476-80
[11] Lee NL., Gielow WO., Wallace RG., 1981, Mechanism of araC autoregulation and the domains of two overlapping promoters, Pc and PBAD, in the L-arabinose regulatory region of Escherichia coli., Proc Natl Acad Sci U S A 78(2):752-6
[12] Reeder T., Schleif R., 1993, AraC protein can activate transcription from only one position and when pointed in only one direction., J Mol Biol 231(2):205-18
[13] Stoner C., Schleif R., 1983, The araE low affinity L-arabinose transport promoter. Cloning, sequence, transcription start site and DNA binding sites of regulatory proteins., J Mol Biol 171(4):369-81
[14] Hendrickson W., Stoner C., Schleif R., 1990, Characterization of the Escherichia coli araFGH and araJ promoters., J Mol Biol 215(4):497-510
[15] Lu Y., Flaherty C., Hendrickson W., 1992, AraC protein contacts asymmetric sites in the Escherichia coli araFGH promoter., J Biol Chem 267(34):24848-57
[16] Johnson CM., Schleif RF., 2000, Cooperative action of the catabolite activator protein and AraC in vitro at the araFGH promoter., J Bacteriol 182(7):1995-2000
[17] Reeder T., Schleif R., 1991, Mapping, sequence, and apparent lack of function of araJ, a gene of the Escherichia coli arabinose regulon., J Bacteriol 173(24):7765-71
[18] Desai TA., Rao CV., 2010, Regulation of arabinose and xylose metabolism in Escherichia coli., Appl Environ Microbiol 76(5):1524-32
[19] Stringer AM., Currenti S., Bonocora RP., Baranowski C., Petrone BL., Palumbo MJ., Reilly AA., Zhang Z., Erill I., Wade JT., 2014, Genome-scale analyses of Escherichia coli and Salmonella enterica AraC reveal noncanonical targets and an expanded core regulon., J Bacteriol 196(3):660-71
[20] Hendrickson W., Flaherty C., Molz L., 1992, Sequence elements in the Escherichia coli araFGH promoter., J Bacteriol 174(21):6862-71
[21] Miyada CG., Stoltzfus L., Wilcox G., 1984, Regulation of the araC gene of Escherichia coli: catabolite repression, autoregulation, and effect on araBAD expression., Proc Natl Acad Sci U S A 81(13):4120-4
[22] Lobell RB, Schleif RF, 1990, DNA looping and unlooping by AraC protein., Science, 250(4980):528 10.1126/science.2237403
[23] Hamilton EP., Lee N., 1988, Three binding sites for AraC protein are required for autoregulation of araC in Escherichia coli., Proc Natl Acad Sci U S A 85(6):1749-53
[24] Martin K, Huo L, Schleif RF, 1986, The DNA loop model for ara repression: AraC protein occupies the proposed loop sites in vivo and repression-negative mutations lie in these same sites., Proc Natl Acad Sci U S A, 83(11):3654 10.1073/pnas.83.11.3654
[25] Carra JH, Schleif RF, 1993, Variation of half-site organization and DNA looping by AraC protein., EMBO J, 12(1):35 10.1002/j.1460-2075.1993.tb05629.x
[26] Tischer A, Brown MJ, Schleif RF, Auton M, 2019, Arabinose Alters Both Local and Distal H-D Exchange Rates in the Escherichia coli AraC Transcriptional Regulator., Biochemistry, 58(26):2875 10.1021/acs.biochem.9b00389
[27] Rodgers ME, Schleif R, 2009, Solution structure of the DNA binding domain of AraC protein., Proteins, 77(1):202 10.1002/prot.22431
[28] Gallegos MT, Michán C, Ramos JL, 1993, The XylS/AraC family of regulators., Nucleic Acids Res, 21(4):807 10.1093/nar/21.4.807
[29] Cole SD, Schleif R, 2012, A new and unexpected domain-domain interaction in the AraC protein., Proteins, 80(5):1465 10.1002/prot.24044
[30] Soisson SM, MacDougall-Shackleton B, Schleif R, Wolberger C, 1997, The 1.6 A crystal structure of the AraC sugar-binding and dimerization domain complexed with D-fucose., J Mol Biol, 273(1):226 10.1006/jmbi.1997.1314
[31] Soisson SM, MacDougall-Shackleton B, Schleif R, Wolberger C, 1997, Structural basis for ligand-regulated oligomerization of AraC., Science, 276(5311):421 10.1126/science.276.5311.421
[32] Rodgers ME, Holder ND, Dirla S, Schleif R, 2009, Functional modes of the regulatory arm of AraC., Proteins, 74(1):81 10.1002/prot.22137
[33] Seedorff J, Schleif R, 2011, Active role of the interdomain linker of AraC., J Bacteriol, 193(20):5737 10.1128/JB.05339-11
[34] Malaga F, Mayberry O, Park DJ, Rodgers ME, Toptygin D, Schleif RF, 2016, A genetic and physical study of the interdomain linker of E. Coli AraC protein--a trans-subunit communication pathway., Proteins, 84(4):448 10.1002/prot.24990

RegulonDB

DNA binding site length:	17
DNA binding site symmetry:	inverted-repeat