![]() ![]() |
Synonyms: BaeR-phosphorylated, BaeR |
Summary:
BaeR (bacterial adaptive response, response-regulator [9]) has been shown to regulate directly genes involved in drug resistance [4, 5, 10, 11] and indirectly appears to regulate genes involved in several cellular processes, such as flagellum biosynthesis, chemotaxis, and maltose transport [4]. BaeR belongs to the BaeS/BaeR two-component system [1, 9]. Both genes, baeR, encoding the response regulator, and baeS, encoding the sensor kinase, are located at the end of the operon (mdtABCD-baeSR) regulated by BaeR [5]. It has been suggested that BaeS senses envelope disorder [7, 8]. Indole [2, 8] and zinc [7] have been used as inducers of this disorder. Read more > |
Transcription factor | ![]() ![]() |
|||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
TF conformation(s): |
|
|||||||||||||||||||||
Evolutionary Family: | OmpR | |||||||||||||||||||||
TFBs length: | 20 | |||||||||||||||||||||
TFBs symmetry: | inverted-repeat | |||||||||||||||||||||
Sensing class: | External-Two-component systems | |||||||||||||||||||||
Connectivity class: | Local Regulator | |||||||||||||||||||||
Gene name: | baeR | |||||||||||||||||||||
Genome position: | 2164276-2164998 | |||||||||||||||||||||
Length: | 723 bp / 240 aa | |||||||||||||||||||||
Operon name: | mdtABCD-baeSR | |||||||||||||||||||||
TU(s) encoding the TF: |
|
Regulon |
![]() ![]() |
||||||
---|---|---|---|---|---|---|---|
Regulated gene(s) | acrD, baeR, baeS, mdtA, mdtB, mdtC, mdtD, spy | ||||||
Multifun term(s) of regulated gene(s) |
MultiFun Term (List of genes associated to the multifun term)
membrane (6)
Porters (Uni-, Sym- and Antiporters) (3)
two component regulatory systems (external signal) (2)
Electrochemical potential driven transporters (1)
drug resistance/sensitivity (1)
Read more >
|
||||||
Regulated operon(s) | acrD, mdtABCD-baeSR, spy | ||||||
First gene in the operon(s) | acrD, mdtA, spy | ||||||
Simple and complex regulons | BaeR,CpxR | ||||||
Simple and complex regulatory phrases | Regulatory phrase (List of promoters regulated by the phrase) |
Transcription factor regulation |
![]() |
---|
Functional conformation | Function | Promoter | Sigma factor | Central Rel-Pos | Distance to first Gene | Genes | Sequence | LeftPos | RightPos | Evidence | Confidence level (C: Confirmed, S: Strong, W: Weak) | References | |
---|---|---|---|---|---|---|---|---|---|---|---|---|---|
BaeR-phosphorylated | activator | acrDp2 | Sigma54 | -36.5 | -81.5 | acrD |
acattaactcCTTTTTTTCTCCACGATTGGctcgtacctt
|
2587504 | 2587523 | [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [IC], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS], [IC] | S | [2], [2] | |
BaeR-phosphorylated | activator | mdtAp | Sigma38 | -27.5 | -64.5 | mdtA, mdtB, mdtC, mdtD, baeS, baeR |
cataattcctCCATTTTTCTCCCTTATTGGctggctacac
|
2153942 | 2153961 | [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [COMP-AINF-SIMILAR-TO-CONSENSUS], [EXP-CHIP-EXO], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS] | C | [2], [2], [3], [4], [4], [5], [6] | |
BaeR-phosphorylated | activator | spyp | Sigma70 | -157.5 | -220.5 | spy |
ccagtcatccGGTATAGTTCTTCATAATCTctgcaaaatc
|
1825836 | 1825855 | [IC], [COMP-HINF-SIMILAR-TO-CONSENSUS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS], [IC] | S | [7], [7] | |
BaeR-phosphorylated | activator | spyp | Sigma70 | -86.5 | -149.5 | spy |
atcaaattttCTTTTTTTCTCCATAATTGGcgcaaaagtg
|
1825765 | 1825784 | [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [COMP-AINF-SIMILAR-TO-CONSENSUS], [COMP-HINF-SIMILAR-TO-CONSENSUS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS] | S | [4], [4], [7], [7], [8] |
Functional conformation | Function | Object name | Object type | Distance to first Gene | Sequence | LeftPos | RightPos | Center Position | Growth Condition | Evidence | Confidence level (C: Confirmed, S: Strong, W: Weak) | References | |
---|---|---|---|---|---|---|---|---|---|---|---|---|---|
BaeR-phosphorylated | activator | ycaC | Transcription-Unit | nd | nd | nd | nd | nd | [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [COMP-HINF-SIMILAR-TO-CONSENSUS] | W | [4] |
Alignment and PSSM for BaeR TFBSs | ![]() |
---|
Aligned TFBS of BaeR |
---|
Sequence | |
---|---|
CTTTTTTTCTCCATAATTGGCGC | |
CTTTTTTTCTCCACGATTGGCTC | |
CCATTTTTCTCCCTTATTGGCTG | |
GTATAGTTCTTCATAATCTCTGC |
Position weight matrix (PWM). BaeR matrix-quality result |
---|
A 0 0 2 0 1 0 0 0 0 0 0 0 3 0 2 4 0 0 0 0 0 0 0 C 3 1 0 0 0 0 0 0 4 0 3 4 1 1 0 0 0 1 0 1 3 0 3 G 1 0 0 0 0 1 0 0 0 0 0 0 0 0 1 0 0 0 3 3 0 2 1 T 0 3 2 4 3 3 4 4 0 4 1 0 0 3 1 0 4 3 1 0 1 2 0 |
Consensus |
---|
; consensus.strict CtaTttTTCTCCataATtGGCgC ; consensus.strict.rc GCGCCAATTATGGAGAAAAATAG ; consensus.IUPAC SywTtkTTCTCCmyrATyGSCkS ; consensus.IUPAC.rc SMGSCRATYRKGGAGAAMAAWRS ; consensus.regexp [CG][ct][at]Tt[gt]TTCTCC[ac][ct][ag]AT[ct]G[CG]C[gt][CG] ; consensus.regexp.rc [CG][AC]G[CG]C[AG]AT[CT][AG][GT]GGAGAA[AC]AA[AT][AG][CG] |
Evolutionary conservation of regulatory elements | ![]() |
---|
Reference(s) |
![]() |
---|---|