![]() ![]() |
Synonyms: GlpR-sn-glycerol 3-phosphate, GlpR-glycerol, GlpR |
Summary:
The sn-Glycerol-3-phosphate repressor," GlpR, acts as the repressor of the glycerol-3-phosphate regulon, which is organized in different operons [1, 2, 4, 6, 7, 8, 9]. However, the array of promoters repressed by GlpR has been expanded [10].This regulator is part of the glpEGR operon, yet it can also be constitutively expressed as an independent (glpR) transcription unit [11, 12]. In addition, the operons regulated are induced when Escherichia coli is grown in the presence of inductor, glycerol, or glycerol-3-phosphate (G3P), and the absence of glucose [8] In the absence of inductor, this repressor binds in tandem to inverted repeat sequences that consist of 20-nucleotide-long DNA target sites [2, 3, 8]. In contrast, [10] discovered operons whose regulation appears to be mediated by a single GlpR site per operon. Binding of GlpR to DNA is diminished in the presence of the inducers glycerol or G3P. Read more > |
Transcription factor | ![]() ![]() |
||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
TF conformation(s): |
|
||||||||||||||||||||||||||||
Evolutionary Family: | DeoR | ||||||||||||||||||||||||||||
TFBs length: | 20 | ||||||||||||||||||||||||||||
TFBs symmetry: | inverted-repeat | ||||||||||||||||||||||||||||
Sensing class: | Sensing external and internal signals | ||||||||||||||||||||||||||||
Connectivity class: | Local Regulator | ||||||||||||||||||||||||||||
Gene name: | glpR | ||||||||||||||||||||||||||||
Genome position: | 3559848-3560605 | ||||||||||||||||||||||||||||
Length: | 758 bp / 251 aa | ||||||||||||||||||||||||||||
Operon name: | glpEGR | ||||||||||||||||||||||||||||
TU(s) encoding the TF: |
|
Regulon |
![]() ![]() |
||||||
---|---|---|---|---|---|---|---|
Regulated gene(s) | glpA, glpB, glpC, glpD, glpF, glpK, glpQ, glpT, glpX | ||||||
Multifun term(s) of regulated gene(s) |
MultiFun Term (List of genes associated to the multifun term)
misc. glycerol metabolism (8)
membrane (5)
anaerobic respiration (4)
electron donors (4)
aerobic respiration (2)
Read more >
|
||||||
Regulated operon(s) | glpABC, glpD, glpFKX, glpTQ | ||||||
First gene in the operon(s) | glpA, glpD, glpF, glpT | ||||||
Simple and complex regulons | ArcA,CRP,FNR,Fis,FlhDC,GlpR ArcA,CRP,GlpR CRP,FNR,Fis,GlpR,IHF CRP,GlpR | ||||||
Simple and complex regulatory phrases | Regulatory phrase (List of promoters regulated by the phrase) |
Transcription factor regulation |
![]() |
---|
Alignment and PSSM for GlpR TFBSs | ![]() |
---|
Aligned TFBS of GlpR |
---|
Sequence | |
---|---|
AATATGTTCGATAACGAACATT | |
AATATGCGCGAAATCAAACAAT | |
AATTTGCGCCAAAACGCAAACC | |
AAATGGCGCGATAACGCTCATT | |
AAAACGCGCGGATTCGAGCGAT | |
ATTAAGCGCGGATTCGAATATT | |
TTTTTGCTCGTTAACGATAAGT | |
GATTTGCTCAAATTCGCGCTGC | |
TAAATGGTAAAAAACGAACTTC | |
TTTATGAGCTTTAACGAAAGTG | |
AAAACGAGAAATATCGAACTTA | |
AAAATGTTCAAAATGACGCATG | |
AATGTGTGCGGCAATTCACATT | |
CCCATGATGAATTTCGAAAATC | |
ATCGTGATCCATTACGACCGCG | |
TTTATGACGAGGCACACACATT | |
TATTCGCTCATAATTCGAAAGT |
Position weight matrix (PWM). GlpR matrix-quality result |
---|
A 10 11 5 10 1 0 5 0 2 7 10 8 11 9 0 3 10 11 5 11 2 1 C 1 1 2 0 3 0 8 1 13 2 0 1 1 0 14 1 6 1 11 0 2 4 G 1 0 0 2 1 17 1 8 2 7 4 1 0 0 1 12 1 3 0 3 3 3 T 5 5 10 5 12 0 3 8 0 1 3 7 5 8 2 1 0 2 1 3 10 9 |
Consensus |
---|
; consensus.strict aatatGcgCgaaaaCGaaCatt ; consensus.strict.rc AATGTTCGTTTTCGCGCATATT ; consensus.IUPAC aawatGmkCrrwawCGmaMaty ; consensus.IUPAC.rc RATKTKCGWTWYYGMKCATWTT ; consensus.regexp aa[at]atG[ac][gt]C[ag][ag][at]a[at]CG[ac]a[AC]at[ct] ; consensus.regexp.rc [AG]AT[GT]T[GT]CG[AT]T[AT][CT][CT]G[AC][GT]CAT[AT]TT |
Evolutionary conservation of regulatory elements | ![]() |
---|
Reference(s) |
![]() |
---|---|