![]() ![]() |
Synonyms: LeuO |
Summary:
LeuO is a dual transcriptional regulator that regulates genes involved in leucine biosynthesis [12, 14], genes involved in the utilization of certain β-glucosides [1, 2] and genes encoding LuxR-type transcription factors [13] It is also involved in the bacterial stringent response [15]. LeuO is one of the transcription factors that counteracts H-NS-mediated repression of specific loci [1, 2, 9, 12, 16] Overproduction of LeuO causes the phenotype Bgl+, since LeuO can unsilence the bglGFB operon, which is silenced (phenotypically Bgl ) under laboratory conditions [2] LeuO is part of the RpoS/H-NS/Hfq/LeuO/DsrA RNA regulatory cascade that controls the bglGFH operon [1]and translation of rpoS, particularly at low temperatures [17, 18]. LeuO belongs to the LysR transcriptional regulator family and contains a helix-turn-helix DNA-binding domain [2, 19] No LeuO consensus binding sequence is known [13]. LeuO activates transcription of the divergent leuLABCD operon [11]. An in vivo genetic selection (SELEX) and phenotype microarray analysis revealed several multidrug resistance genes as targets for LeuO, including acrEF, ygcLKJIH-ygbTF, and mdtNOP (sdsRQP). Read more > |
Transcription factor | ![]() ![]() |
||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
TF conformation(s): |
|
||||||||||||||
Evolutionary Family: | LysR | ||||||||||||||
TFBs length: | 21 | ||||||||||||||
TFBs symmetry: | inverted-repeat | ||||||||||||||
Sensing class: | Using internal synthesized signals | ||||||||||||||
Connectivity class: | Local Regulator | ||||||||||||||
Gene name: | leuO | ||||||||||||||
Genome position: | 84368-85312 | ||||||||||||||
Length: | 945 bp / 314 aa | ||||||||||||||
Operon name: | leuO | ||||||||||||||
TU(s) encoding the TF: |
|
Regulon |
![]() ![]() |
||||||
---|---|---|---|---|---|---|---|
Regulated gene(s) | bglB, bglF, bglG, bglJ, cadC, cas1, cas2, casA, casB, casC, casD, casE, dsrA, leuA, leuB, leuC, leuD, leuL, leuO, yjjQ | ||||||
Multifun term(s) of regulated gene(s) |
MultiFun Term (List of genes associated to the multifun term)
defense/survival (7)
leucine (6)
carbon compounds (4)
Transcription related (4)
activator (4)
Read more >
|
||||||
Regulated operon(s) | bglGFB, cadC, casABCDE12, dsrA, leuLABCD, leuO, yjjQ-bglJ | ||||||
First gene in the operon(s) | bglG, cadC, casA, dsrA, leuL, leuO, yjjQ | ||||||
Simple and complex regulons | CRP,Fis,H-NS,LeuO,RcsB-BglJ,StpA CRP,H-NS,LeuO,SlyA,StpA CadC,FNR,H-NS,LeuO,MlrA,OmpR DksA-ppGpp,LeuO H-NS,LeuO Read more > | ||||||
Simple and complex regulatory phrases | Regulatory phrase (List of promoters regulated by the phrase) |
Transcription factor regulation |
![]() |
---|
Functional conformation | Function | Object name | Object type | Distance to first Gene | Sequence | LeftPos | RightPos | Center Position | Growth Condition | Evidence | Confidence level (C: Confirmed, S: Strong, W: Weak) | References | |
---|---|---|---|---|---|---|---|---|---|---|---|---|---|
LeuO | repressor | gltF | Transcription-Unit | nd |
aaattgtctcGATATTAATATACAAAATATGAATATAAAAAACCaatatattat
|
3360885 | 3360918 | 3360901.0 | nd | [EXP-IEP-MICROARRAY], [COMP-AINF-SIMILAR-TO-CONSENSUS], [EXP-GSELEX] | S | [6], [8], [9] | |
LeuO | repressor | ybeQ | Transcription-Unit | nd |
gcctcgcaatGCGGCTAATATTCATTTAATGAATATTTAAGGATaaattatatg
|
676670 | 676703 | 676686.0 | nd | [EXP-IEP-MICROARRAY], [COMP-AINF-SIMILAR-TO-CONSENSUS], [EXP-GSELEX] | S | [6], [8], [9] | |
LeuO | repressor | yghSR | Transcription-Unit | nd |
tacgctttcaTAAAAACATATTAACCAAATAAATATTTTTAATGgatatttaaa
|
3134072 | 3134105 | 3134088.0 | nd | [EXP-IEP-MICROARRAY], [COMP-AINF-SIMILAR-TO-CONSENSUS], [EXP-GSELEX] | S | [6], [8], [9] |
Alignment and PSSM for LeuO TFBSs | ![]() |
---|
Aligned TFBS of LeuO |
---|
Sequence | |
---|---|
ATAATTACCATGAATTTTATTAC | |
ATTCATACTGTGAATATAAAATC | |
ATTTGTCTGGTGAATTATTTGTC | |
ATTAAACCAATGAATATATTTTT | |
ATTGATTTGGTGAATATTATTGA | |
ATAACTACCGCGAATACTCAATC | |
ATTCTTAACATTAATTGATCAAT | |
TTAATTATTGGGATTTGTTATAT | |
ATCTACAAAATGGATTAAATGTG | |
ATACATATATTAAGATGTGTTGA |
Position weight matrix (PWM). LeuO matrix-quality result |
---|
A 9 0 4 4 5 1 7 2 3 4 0 1 9 8 1 4 2 4 4 3 3 3 2 C 0 0 1 3 1 1 2 4 3 0 1 0 0 0 0 0 1 0 1 1 0 0 4 G 0 0 0 1 1 0 0 0 2 5 1 8 1 1 0 0 3 0 1 0 2 2 1 T 1 10 5 2 3 8 1 4 2 1 8 1 0 1 9 6 4 6 4 6 5 5 3 |
Consensus |
---|
; consensus.strict ATtcataccgtGAaTtgtatttc ; consensus.strict.rc GAAATACAATTCACGGTATGAAT ; consensus.IUPAC ATwmwtaymrtGAaTwkwwwwwy ; consensus.IUPAC.rc RWWWWWMWATTCAYKRTAWKWAT ; consensus.regexp AT[at][ac][at]ta[ct][ac][ag]tGAaT[at][gt][at][at][at][at][at][ct] ; consensus.regexp.rc [AG][AT][AT][AT][AT][AT][AC][AT]ATTCA[CT][GT][AG]TA[AT][GT][AT]AT |
Evolutionary conservation of regulatory elements | ![]() |
---|
Reference(s) |
![]() |
---|---|