RegulonDB RegulonDB 11.2:Regulon Page
   

MelR DNA-binding transcriptional dual regulator

Synonyms: MelR, MelR-melibiose
Summary:
MelR, "melibiose regulator," is a transcription factor involved in disaccharide melibiose degradation. It coregulates with CRP, a global transcriptional regulator [1, 5, 11] These regulators bind cooperatively to activate transcription of the operon involved in transport and catabolism of melibiose. Synthesis of this operon is induced when Escherichia coli is grown on melibiose in the absence of glucose. Gene induction occurs when the physiological inducer, melibiose, binds to the MelR regulator and when cellular cyclic AMP levels are high. In the presence of melibiose, MelR binds in tandem to repeat sequences in the melR/melAB intergenic region to activate transcription by overlapping the -35 box of the promoter melAp. The binding targets for MelR consist of 18-nucleotide-long repeat sequences that possess conserved motifs; each monomer binds to one of these conserved sequences [1, 5, 10] MelR binds to five target sites in the melAp region. MelR binds to the less-conserved site (-42.5) with less strength; this binding occurs only in the presence of melibiose, and it is absolutely required for expression of melAp [1] MelR binding to the distal site (-237.5) has been shown to down-regulate the expression of melRp and melAp [3, 4] In the absence of melibiose, MelR is unable to activate melAp, but it regulates its own expression by repressing melRp and melAp simultaneously [1, 12, 13] Melibiose triggers MelR-dependent activation of melAp and relieves MelR-dependent repression of melRp [12, 13] The melAB operon is located upstream of melR and in the opposite direction. This regulator belongs to the AraC/XylS family of activators and occurs as both a monomer and a homodimer.
Read more >


Transcription factor      
TF conformation(s):
Name Conformation Type TF-Effector Interaction Type Apo/Holo Conformation Evidence Confidence level (C: Confirmed, S: Strong, W: Weak) References
MelR Functional   Apo [EXP-IDA], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS], [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [EXP-IPI] S [1], [2]
MelR-melibiose Functional Allosteric Holo [EXP-IDA], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS], [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [EXP-IPI] S [1], [2]
Evolutionary Family: AraC/XylS
TFBs length: 18
TFBs symmetry: asymmetric
Sensing class: Sensing external and internal signals
Connectivity class: Local Regulator
Gene name: melR
  Genome position: 4340720-4341628
  Length: 909 bp / 302 aa
Operon name: melR
TU(s) encoding the TF:
Transcription unit        Promoter
melR
melRp


Regulon       
Regulated gene(s) melA, melB, melR
Multifun term(s) of regulated gene(s) MultiFun Term (List of genes associated to the multifun term)
carbon compounds (3)
Porters (Uni-, Sym- and Antiporters) (1)
membrane (1)
Transcription related (1)
activator (1)
Regulated operon(s) melAB, melR
First gene in the operon(s) melA, melR
Simple and complex regulons CRP,MelR
Simple and complex regulatory phrases Regulatory phrase (List of promoters regulated by the phrase)
[MelR,-](2)
[MelR,+](2)


Transcription factor regulation    


Transcription factor binding sites (TFBSs) arrangements
      

  Functional conformation Function Promoter Sigma factor Central Rel-Pos Distance to first Gene Genes Sequence
 LeftPos RightPos Evidence Confidence level (C: Confirmed, S: Strong, W: Weak) References
  MelR repressor melAp Sigma70 -238.5 -262.5 melA, melB
gatggctctcTTTCCTGGAATATCAGAAttatggcagg
 4341640 4341657 [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [COMP-HINF-SIMILAR-TO-CONSENSUS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS], [EXP-IMP-SITE-MUTATION] C [1], [1], [2], [3], [3], [4]
  MelR-melibiose activator melAp Sigma70 -120.5 -144.5 melA, melB
aggccgaaaaCTCTGCTTTTCAGGTAATttattcccat
 4341758 4341775 [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [COMP-HINF-SIMILAR-TO-CONSENSUS], [EXP-DAP-SEQ], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS] C [1], [1], [2], [3], [4], [4], [5], [5], [6], [7], [8]
  MelR-melibiose activator melAp Sigma70 -100.5 -124.5 melA, melB
caggtaatttATTCCCATAAACTCAGATttactgctgc
 4341778 4341795 [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [COMP-HINF-SIMILAR-TO-CONSENSUS], [EXP-DAP-SEQ], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS] C [1], [1], [2], [3], [4], [4], [5], [5], [6], [7]
  MelR repressor melAp Sigma70 -62.5 -86.5 melA, melB
ttcacgcaggATCTGAGTTTATGGGAATgctcaacctg
 4341816 4341833 [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS] S [1], [1], [2], [3], [3], [4], [4], [5], [8], [9], [9], [10], [10]
  MelR-melibiose activator melAp Sigma70 -62.5 -86.5 melA, melB
ttcacgcaggATCTGAGTTTATGGGAATgctcaacctg
 4341816 4341833 [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS] S [1], [1], [2], [3], [3], [4], [4], [5], [8], [9], [9], [10], [10]
  MelR-melibiose activator melAp Sigma70 -42.5 -66.5 melA, melB
atgggaatgcTCAACCTGGAAGCCGGAGgttttctgca
 4341836 4341853 [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS], [EXP-IMP-SITE-MUTATION] C [1], [1], [3], [3], [4], [4], [5], [8], [9], [9], [10], [10]
  MelR-melibiose activator melRp Sigma70 -194.5 -216.5 melR
tgcagaaaacCTCCGGCTTCCAGGTTGAgcattcccat
 4341836 4341853 [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS], [EXP-IMP-SITE-MUTATION] C [1], [3], [4], [4], [5], [8], [9], [10]
  MelR repressor melRp Sigma70 -174.5 -196.5 melR
caggttgagcATTCCCATAAACTCAGATcctgcgtgaa
 4341816 4341833 [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS] S [1], [1], [2], [2], [3], [3], [4], [4], [5], [8], [9], [10]
  MelR-melibiose repressor melRp Sigma70 -136.5 -158.5 melR
gcagcagtaaATCTGAGTTTATGGGAATaaattacctg
 4341778 4341795 [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [COMP-HINF-SIMILAR-TO-CONSENSUS], [EXP-DAP-SEQ], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS] C [1], [1], [2], [2], [3], [4], [4], [5], [6], [7], [7]
  MelR-melibiose repressor melRp Sigma70 -116.5 -138.5 melR
atgggaataaATTACCTGAAAAGCAGAGttttcggcct
 4341758 4341775 [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [COMP-HINF-SIMILAR-TO-CONSENSUS], [EXP-DAP-SEQ], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS] C [1], [1], [2], [2], [3], [4], [4], [5], [6], [7], [7], [8]
  MelR repressor melRp Sigma70 2.5 -20.5 melR
cctgccataaTTCTGATATTCCAGGAAAgagagccatc
 4341640 4341657 [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [COMP-HINF-SIMILAR-TO-CONSENSUS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS], [EXP-IMP-SITE-MUTATION] C [1], [1], [2], [2], [3], [3], [4]


Alignment and PSSM for MelR TFBSs    

Aligned TFBS of MelR   
  Sequence
  ATTCCCATAAACTCAGATTTA
  ATTACCTGAAAAGCAGAGTTT
  ATTCCCATAAACTCAGATCCT
  TTTCCTGGAATATCAGAATTA
  TCAACCTGGAAGCCGGAGGTT

Position weight matrix (PWM). MelR matrix-quality result    
A	3	0	1	2	0	0	2	0	4	5	4	2	0	0	4	0	5	1	0	0	2
C	0	1	0	3	5	4	0	0	0	0	0	2	1	5	0	0	0	0	1	1	0
G	0	0	0	0	0	0	1	3	1	0	0	1	1	0	1	5	0	2	1	0	0
T	2	4	4	0	0	1	2	2	0	0	1	0	3	0	0	0	0	2	3	4	3

Consensus    
;	consensus.strict             	attcCCagaAactCaGAgttt
;	consensus.strict.rc          	AAACTCTGAGTTTCTGGGAAT
;	consensus.IUPAC              	wttmCCwkaAamtCaGAkttw
;	consensus.IUPAC.rc           	WAAMTCTGAKTTTMWGGKAAW
;	consensus.regexp             	[at]tt[ac]CC[at][gt]aAa[ac]tCaGA[gt]tt[at]
;	consensus.regexp.rc          	[AT]AA[AC]TCTGA[GT]TTT[AC][AT]GG[GT]AA[AT]

PWM logo   


 


Evolutionary conservation of regulatory elements    
     Note: Evolutionary conservation of regulatory interactions and promoters is limited to gammaproteobacteria.
TF-target gene evolutionary conservation
Promoter-target gene evolutionary conservation


Evidence    

 [EXP-IDA] Inferred from direct assay

 [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS] Binding of purified proteins

 [EXP-IEP-GENE-EXPRESSION-ANALYSIS] Gene expression analysis

 [EXP-IPI] Inferred from physical interaction

 [COMP-HINF-SIMILAR-TO-CONSENSUS] A person inferred or reviewed a computer inference of sequence function based on similarity to a consensus sequence.

 [EXP-IMP-SITE-MUTATION] Site mutation

 [EXP-DAP-SEQ] high throughput DNA Affinity Purification (DAP) Sequencing


Reference(s)    

 [1] Belyaeva TA., Wade JT., Webster CL., Howard VJ., Thomas MS., Hyde EI., Busby SJ., 2000, Transcription activation at the Escherichia coli melAB promoter: the role of MelR and the cyclic AMP receptor protein., Mol Microbiol 36(1):211-22

 [2] Samarasinghe S., El-Robh MS., Grainger DC., Zhang W., Soultanas P., Busby SJ., 2008, Autoregulation of the Escherichia coli melR promoter: repression involves four molecules of MelR., Nucleic Acids Res 36(8):2667-76

 [3] Kahramanoglou C., Webster CL., El-Robh MS., Belyaeva TA., Busby SJ., 2006, Mutational analysis of the Escherichia coli melR gene suggests a two-state concerted model to explain transcriptional activation and repression in the melibiose operon., J Bacteriol 188(9):3199-207

 [4] Wade JT., Belyaeva TA., Hyde EI., Busby SJ., 2000, Repression of the Escherichia coli melR promoter by MelR: evidence that efficient repression requires the formation of a repression loop., Mol Microbiol 36(1):223-9

 [5] Wade JT., Belyaeva TA., Hyde EI., Busby SJ., 2001, A simple mechanism for co-dependence on two activators at an Escherichia coli promoter., EMBO J 20(24):7160-7

 [6] Baumgart LA, Lee JE, Salamov A, Dilworth DJ, Na H, Mingay M, Blow MJ, Zhang Y, Yoshinaga Y, Daum CG, O'Malley RC, 2021, Persistence and plasticity in bacterial gene regulation., Nat Methods, 18(12):1499 10.1038/s41592-021-01312-2

 [7] Howard VJ., Belyaeva TA., Busby SJ., Hyde EI., 2002, DNA binding of the transcription activator protein MelR from Escherichia coli and its C-terminal domain., Nucleic Acids Res 30(12):2692-700

 [8] Williams J., Michan C., Webster C., Busby S., 1994, Interactions between the Escherichia coli MelR transcription activator protein and operator sequences at the melAB promoter., Biochem J 300 ( Pt 3):757-63

 [9] Grainger DC., Belyaeva TA., Lee DJ., Hyde EI., Busby SJ., 2003, Binding of the Escherichia coli MelR protein to the melAB promoter: orientation of MelR subunits and investigation of MelR-DNA contacts., Mol Microbiol 48(2):335-48

 [10] Tamai E., Belyaeva TA., Busby SJ., Tsuchiya T., 2000, Mutations that increase the activity of the promoter of the Escherichia coli melibiose operon improve the binding of MelR, a transcription activator triggered by melibiose., J Biol Chem 275(22):17058-63

 [11] Webster C., Gaston K., Busby S., 1988, Transcription from the Escherichia coli melR promoter is dependent on the cyclic AMP receptor protein., Gene 68(2):297-305

 [12] Tobes R, Ramos JL, 2002, AraC-XylS database: a family of positive transcriptional regulators in bacteria., Nucleic Acids Res, 30(1):318 10.1093/nar/30.1.318

 [13] Gallegos MT., Schleif R., Bairoch A., Hofmann K., Ramos JL., 1997, Arac/XylS family of transcriptional regulators., Microbiol Mol Biol Rev 61(4):393-410

 [14] Michan CM., Busby SJ., Hyde EI., 1995, The Escherichia coli MelR transcription activator: production of a stable fragment containing the DNA-binding domain., Nucleic Acids Res 23(9):1518-23

 [15] Webster C., Gardner L., Busby S., 1989, The Escherichia coli melR gene encodes a DNA-binding protein with affinity for specific sequences located in the melibiose-operon regulatory region., Gene 83(2):207-13

 [16] Caswell R., Williams J., Lyddiatt A., Busby S., 1992, Overexpression, purification and characterization of the Escherichia coli MelR transcription activator protein., Biochem J 287 ( Pt 2):493-9

 [17] Bourgerie SJ., Michan CM., Thomas MS., Busby SJ., Hyde EI., 1997, DNA binding and DNA bending by the MelR transcription activator protein from Escherichia coli., Nucleic Acids Res 25(9):1685-93


RegulonDB