![]() ![]() |
Synonyms: Mlc-EIIGlC, Mlc |
Summary:
DgsA, better known as Mlc, "makes large colonies," [12]is a transcriptional dual regulator that controls the expression of a number of genes encoding enzymes of the Escherichia coli phosphotransferase (PTS) and phosphoenolpyruvate (PEP) systems [13, 14] It also regulates genes involved in the uptake of glucose [5] It is considered a global regulator of carbohydrate metabolism [3, 15]. In addition, Mlc regulates expression of the MalT transcriptional regulator, the activator of the maltose regulon [3]. Mlc repressor function is disabled by binding of Mlc to an actively-transported and dephosphorylated form of PtsG (EIICBGlc) [1, 2] The membrane-bound part of EIICBGlc is essential for Mlc inactivation [2, 16]. Read more > |
Transcription factor | ![]() ![]() |
|||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
TF conformation(s): |
|
|||||||||||||||||||||
Evolutionary Family: | ROK | |||||||||||||||||||||
TFBs length: | 23 | |||||||||||||||||||||
TFBs symmetry: | inverted-repeat | |||||||||||||||||||||
Connectivity class: | Local Regulator | |||||||||||||||||||||
Gene name: | mlc | |||||||||||||||||||||
Genome position: | 1667344-1668564 | |||||||||||||||||||||
Length: | 1221 bp / 406 aa | |||||||||||||||||||||
Operon name: | mlc-bidA | |||||||||||||||||||||
TU(s) encoding the TF: |
|
Regulon |
![]() ![]() |
||||||
---|---|---|---|---|---|---|---|
Regulated gene(s) | bidA, crr, malT, manX, manY, manZ, mlc, ptsG, ptsH, ptsI | ||||||
Multifun term(s) of regulated gene(s) |
MultiFun Term (List of genes associated to the multifun term)
carbon compounds (8)
Phosphotransferase Systems (PEP-dependent PTS) (5)
membrane (4)
Transcription related (2)
operon (2)
Read more >
|
||||||
Regulated operon(s) | malT, manXYZ, mlc-bidA, ptsG, ptsHI-crr | ||||||
First gene in the operon(s) | malT, manX, mlc, ptsG, ptsH | ||||||
Simple and complex regulons | ArcA,CRP,Fis,Mlc,SoxS CRP,Cra,Mlc,NagC CRP,Lrp,Mlc CRP,Mlc CRP,Mlc,NagC Read more > | ||||||
Simple and complex regulatory phrases | Regulatory phrase (List of promoters regulated by the phrase) |
Transcription factor regulation |
![]() |
---|
Alignment and PSSM for Mlc TFBSs | ![]() |
---|
Aligned TFBS of Mlc |
---|
Sequence | |
---|---|
AGTTTTTTTAAAGCTCGTAATTAATG | |
AATTATTTTGATGCGCGAAATTAATC | |
ATTTTTTTTGCGCTTCGTAATTAATG | |
AATTATTTTACTCTGTGTAATAAATA | |
GATTATTTCGGAGCGCGAAAATATAG | |
ATTTATTTTAGATATCGAAAAAATTA | |
GGATATTTTACCTTTCGAAATTTCTG |
Position weight matrix (PWM). Mlc matrix-quality result |
---|
A 5 3 1 0 5 0 0 0 0 4 2 3 0 1 0 0 0 4 7 7 2 2 6 4 1 2 C 0 0 0 0 0 0 0 0 1 0 3 1 2 3 0 6 0 0 0 0 0 0 0 1 0 1 G 2 2 0 0 0 0 0 0 0 3 2 1 3 0 3 0 7 0 0 0 0 0 0 0 0 4 T 0 2 6 7 2 7 7 7 6 0 0 2 2 3 4 1 0 3 0 0 5 5 1 2 6 0 |
Consensus |
---|
; consensus.strict aatTaTTTtgcagcgCGaAAttaatg ; consensus.strict.rc CATTAATTTCGCGCTGCAAAATAATT ; consensus.IUPAC rrtTaTTTtrsasykCGwAAttaatg ; consensus.IUPAC.rc CATTAATTWCGMRSTSYAAAATAAYY ; consensus.regexp [ag][ag]tTaTTTt[ag][cg]a[cg][ct][gt]CG[at]AAttaatg ; consensus.regexp.rc CATTAATT[AT]CG[AC][AG][CG]T[CG][CT]AAAATAA[CT][CT] |
Evolutionary conservation of regulatory elements | ![]() |
---|
Reference(s) |
![]() |
---|---|