|
|
| Synonyms: MlrA |
|
Summary:
MlrA is a regulator of curli production in an avian pathogenic Escherichia coli strain and in Salmonella enterica serovar Typhimurium [2]. Shiga toxin-encoding prophages have been observed to integrate at the mlrA gene of enterohemorrhagic E. coli [3]. MlrA is a member of the MerR family, containing the conserved N-terminal DNA-binding domain present in members of this family [1, 2]. On the other hand, its C-terminal domain, probably used by a yet-to-be-identified effector, showed no similarity to any of the hitherto-characterized MerR family members [1]. MlrA binds an AAAGTTGTACA(12N)TGCACAATTTT palindromic sequence and probably induces DNA underwinding, as in the case of MerR [1]. Based on the site identified on the csgDp1 promoter, sites for another four genes were identified, two of which are transcriptional regulators [1]. Read more > |
| Transcription factor |  |
||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| TF conformation(s): |
|
||||||||||||||
| Evolutionary Family: | MerR | ||||||||||||||
| TFBs symmetry: | inverted-repeat | ||||||||||||||
| Connectivity class: | Local Regulator | ||||||||||||||
| Gene name: | mlrA | ||||||||||||||
| Genome position: | 2214866-2215597 | ||||||||||||||
| Length: | 732 bp / 243 aa | ||||||||||||||
| Operon name: | mlrA | ||||||||||||||
| TU(s) encoding the TF: |
|
| Regulon |
|
||||||
|---|---|---|---|---|---|---|---|
| Regulated gene(s) | cadC, csgD, csgE, csgF, csgG, ibaG, obgE, rplU, rpmA, yhbE | ||||||
| Multifun term(s) of regulated gene(s) |
MultiFun Term (List of genes associated to the multifun term)
Transcription related (2)
activator (2)
membrane (2)
translation (2)
ribosomal proteins (2)
Read more >
|
||||||
| Regulated operon(s) | cadC, csgDEFG, ibaG-murA, rplU-rpmA-yhbE-obgE | ||||||
| First gene in the operon(s) | cadC, csgD, ibaG, rplU | ||||||
| Simple and complex regulons | BasR,BolA,BtsR,CRP,CpxR,Cra,CsgD,FliZ,H-NS,IHF,MlrA,MqsA,OmpR,RcdA,RcsAB,RstA,ppGpp BasR,BtsR,CRP,CpxR,Cra,CsgD,FliZ,H-NS,IHF,MlrA,MqsA,OmpR,RcdA,RcsAB,RstA CadC,FNR,H-NS,LeuO,MlrA,OmpR DksA-ppGpp,MlrA MlrA | ||||||
| Simple and complex regulatory phrases | Regulatory phrase (List of promoters regulated by the phrase) | ||||||
| Transcription factor regulation |
|
|---|
|
Transcription factor binding sites (TFBSs) arrangements
|
|---|
| Functional conformation | Function | Promoter | Sigma factor | Central Rel-Pos | Distance to first Gene | Genes | Sequence | LeftPos | RightPos | Evidence | Confidence level (C: Confirmed, S: Strong, W: Weak) | References | |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| MlrA | activator | cadCp | Sigma70 | -201.5 | -230.5 | cadC |
aagtgctccgGACAATTTTCCATGGATTATTTTCTGAACATTTTTctttggcaaa
|
4362148 | 4362182 | [COMP-HINF-SIMILAR-TO-CONSENSUS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS] | S | [1], [1] | |
| MlrA | activator | csgDp1 | Sigma70 | -129.5 | -277.5 | csgD, csgE, csgF, csgG |
tatgatttttTAAAATTGTGCAATAAAAACCAAATGTACAACTTTtctatcattt
|
1103457 | 1103491 | [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS] | S | [1], [1] | |
| MlrA | activator | csgDp3 | Sigma38 | -129.5 | -277.5 | csgD, csgE, csgF, csgG |
tatgatttttTAAAATTGTGCAATAAAAACCAAATGTACAACTTTtctatcattt
|
1103457 | 1103491 | [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS] | S | [1], [1] | |
| MlrA | activator | ibaGp2 | Sigma24 | -117.5 | -200.5 | ibaG |
ggggtaaacgACAAAGTGTATACCCTGGCGAAATTGTATAATTTGcctgctgatg
|
3336987 | 3337021 | [COMP-HINF-SIMILAR-TO-CONSENSUS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS] | S | [1], [1] | |
| MlrA | activator | rplUp | Sigma70 | -85.5 | -150.5 | rplU, rpmA, yhbE, obgE |
attgtactgaAAAAATGGCACAGATAAACGTTACCGTACAAGTTGtgtttttttt
|
3333585 | 3333619 | [COMP-HINF-SIMILAR-TO-CONSENSUS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS] | S | [1], [1] |
| Alignment and PSSM for MlrA TFBSs | |
|---|
| Aligned TFBS of MlrA |
|---|
| Sequence | |
|---|---|
| TAGAAAAGTTGTACATTTGGTTTTTATTGCACAATTTT | |
| AACACAACTTGTACGGTAACGTTTATCTGTGCCATTTT | |
| CCGGACAATTTTCCATGGATTATTTTCTGAACATTTTT | |
| CAGGCAAATTATACAATTTCGCCAGGGTATACACTTTG |
| Position weight matrix (PWM). MlrA matrix-quality result |
|---|
A 1 3 0 2 2 3 4 2 0 0 1 0 3 0 3 1 0 1 2 0 0 1 0 1 1 1 0 0 1 1 3 0 3 2 0 0 0 0 C 2 1 1 0 2 1 0 1 0 0 0 0 1 4 0 0 0 0 0 2 0 1 1 0 0 0 2 0 0 1 0 4 1 1 0 0 0 0 G 0 0 3 2 0 0 0 1 0 0 2 0 0 0 1 1 1 1 1 1 2 0 0 0 1 1 1 0 3 0 1 0 0 0 0 0 0 1 T 1 0 0 0 0 0 0 0 4 4 1 4 0 0 0 2 3 2 1 1 2 2 3 3 2 2 1 4 0 2 0 0 0 1 4 4 4 3 |
| Consensus |
|---|
; consensus.strict caGgcaAaTTgTaCatttacgtttttcTGtaCaaTTTt ; consensus.strict.rc AAAATTGTACAGAAAAACGTAAATGTACAATTTGCCTG ; consensus.IUPAC cmSrmmAvTTgTmCrkkkrskyytkksTGyrCmmTTTk ; consensus.IUPAC.rc MAAAKKGYRCASMMARRMSYMMMYGKACAABTKKYSKG ; consensus.regexp c[ac][CG][ag][ac][ac]A[acg]TTgT[ac]C[ag][gt][gt][gt][ag][cg][gt][ct][ct]t[gt][gt][cg]TG[ct][ag]C[ac][ac]TTT[gt] ; consensus.regexp.rc [AC]AAA[GT][GT]G[CT][AG]CA[CG][AC][AC]A[AG][AG][AC][CG][CT][AC][AC][AC][CT]G[GT]ACAA[CGT]T[GT][GT][CT][CG][GT]G |
| PWM logo |
|---|
|
|
| Evolutionary conservation of regulatory elements | |
|---|
| TF-target gene evolutionary conservation |
|
| Promoter-target gene evolutionary conservation |
|
| Reference(s) |
|
|---|---|
[COMP-HINF-SIMILAR-TO-CONSENSUS] A person inferred or reviewed a computer inference of sequence function based on similarity to a consensus sequence.