RegulonDB RegulonDB 11.2:Regulon Page
   

ModE DNA-binding transcriptional dual regulator

Synonyms: ModE, ModE-molybdate
Summary:
The transcription factor ModE, for "Molybdenum," is the principal regulator that controls the transcription of operons involved in the transport of molybdenum and synthesis of molybdoenzymes and molybdate-related functions, among others [1, 2, 4, 6, 8, 9, 10, 11, 12, 13]. The regulatory effect of ModE is induced when E. coli is grown under anaerobic growth conditions and when the physiological inducer, molybdenum, binds to ModE and promotes the dimerization of the ModE-Mo complex [1, 4, 11, 14]. The ModE dimer binds two molecules of molybdenum with a Kd of 0.8 mM. Tungsten can act as a substitute for Mo in ModE binding to the modABCD promoter in vitro, but the complex may be biologically inactive [13]. The binding targets for ModE consist of inverted repeat sequences that possess conserved motifs; each monomer binds to one of these conserved sequences [1, 4, 11, 15].
Read more >


Transcription factor      
TF conformation(s):
Name Conformation Type TF-Effector Interaction Type Apo/Holo Conformation Evidence Confidence level (C: Confirmed, S: Strong, W: Weak) References
ModE Non-Functional   Apo [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS], [EXP-IPI] S [1]
ModE-molybdate Functional Allosteric Holo [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS], [EXP-IPI] S [1]
Evolutionary Family: LysR
TFBs length: 24
Sensing class: External sensing using transported metabolites
Connectivity class: Local Regulator
Gene name: modE
  Genome position: 793856-794644
  Length: 789 bp / 262 aa
Operon name: modEF
TU(s) encoding the TF:
Transcription unit        Promoter
modEF
 


Regulon       
Regulated gene(s) ccmA, ccmB, ccmC, ccmD, ccmE, ccmF, ccmG, ccmH, deoA, deoB, deoC, deoD, dmsA, dmsB, dmsC, hycA, hycB, hycC, hycD, hycE, hycF, hycG, hycH, hycI, moaA, moaB, moaC, moaD, moaE, modA, modB, modC, napA, napB, napC, napD, napF, napG, napH, narL, narX, oppA, oppB, oppC, oppD, oppF
Multifun term(s) of regulated gene(s) MultiFun Term (List of genes associated to the multifun term)
membrane (16)
anaerobic respiration (11)
cytochromes (10)
fermentation (8)
chaperoning, repair (refolding) (7)
Read more >
Regulated operon(s) deoCABD, dmsABC, hycABCDEFGHI, moaABCDE, modABC, napFDAGHBC-ccmABCDEFGH, narXL, oppABCDF
First gene in the operon(s) deoC, dmsA, hycA, moaA, modA, napF, narX, oppA
Simple and complex regulons ArcA,Fur,Lrp,ModE
CRP,CytR,DeoR,Fis,ModE
CRP,ModE
FNR,FlhDC,ModE,NarL,NarP
FNR,ModE
Read more >
Simple and complex regulatory phrases Regulatory phrase (List of promoters regulated by the phrase)
[ModE,-](4)
[ModE,+](5)


Transcription factor regulation    


Transcription factor binding sites (TFBSs) arrangements
      

  Functional conformation Function Promoter Sigma factor Central Rel-Pos Distance to first Gene Genes Sequence LeftPos RightPos Evidence Confidence level (C: Confirmed, S: Strong, W: Weak) References
  ModE-molybdate repressor deoCp2 Sigma70 -35.0 -80.0 deoC, deoA, deoB, deoD
ttccttaattGTGATGTGTATCGAAGTGTGTTGCggagtagatg
 4617231 4617254 [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [COMP-HINF-SIMILAR-TO-CONSENSUS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS] S [2], [2]
  ModE-molybdate repressor dmsAp2 nd -5.0 -86.0 dmsA, dmsB, dmsC
ttcaaattatTCGATGTATACAAGCCTATATAGCgaactgctat
 940861 940884 [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [COMP-HINF-SIMILAR-TO-CONSENSUS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS], [EXP-IMP-SITE-MUTATION] C [3]
  ModE-molybdate activator hycAp Sigma54 -192.0 -218.0 hycA, hycB, hycC, hycD, hycE, hycF, hycG, hycH, hycI
cccgttggcaGAGGGTTATTTCGTGCATATCGCCtcccattaac
 2850641 2850664 [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS] S [4], [4]
  ModE-molybdate activator moaAp2 nd -57.5 -187.5 moaA, moaB, moaC, moaD, moaE
acgatcatgaCGCTATATACATGATTACATAGCGaaagtgtgga
 816845 816868 [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS] S [5], [5]
  ModE-molybdate repressor modAp2 Sigma70 -4.5 -31.5 modA, modB, modC
ccgagttagtCGTTATATTGTCGCCTACATAACGttacattaag
 795046 795069 [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS], [EXP-IMP-SITE-MUTATION] C [1]
  ModE-molybdate activator napFp1 Sigma70 -133.5 -210.5 napF, napD, napA, napG, napH, napB, napC, ccmA, ccmB, ccmC, ccmD, ccmE, ccmF, ccmG, ccmH
gtgaatcaatCGCTATATAAATATATTTATAACCatttgaaatg
 2303696 2303719 [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [COMP-HINF-SIMILAR-TO-CONSENSUS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS], [EXP-IMP-SITE-MUTATION] C [6], [6], [7], [7]
  ModE-molybdate activator napFp2 Sigma70 -130.5 -210.5 napF, napD, napA, napG, napH, napB, napC, ccmA, ccmB, ccmC, ccmD, ccmE, ccmF, ccmG, ccmH
gtgaatcaatCGCTATATAAATATATTTATAACCatttgaaatg
 2303696 2303719 [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [COMP-HINF-SIMILAR-TO-CONSENSUS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS], [EXP-IMP-SITE-MUTATION] C [6], [7], [7]
  ModE-molybdate activator narXp Sigma70 -141.5 -300.5 narX, narL
cgtttcgatgTCTGCCACCTTAGTGTCTGTAGCTaaaggcaatt
 1277907 1277930 [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [COMP-HINF-SIMILAR-TO-CONSENSUS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS] S [4]
  ModE-molybdate repressor oppAp Sigma28 nd nd oppA, oppB, oppC, oppD, oppF
nd
 nd nd [EXP-IEP-GENE-EXPRESSION-ANALYSIS] W [2]


Alignment and PSSM for ModE TFBSs    

Aligned TFBS of ModE   
  Sequence
  CGCTATATACATGATTACATAGCGAAA
  CGATGTATACAAGCCTATATAGCGAAC
  CGTTATATTGTCGCCTACATAACGTTA
  CGCAACACACTTCGATACACATCACAA
  CGATATGCACGAAATAACCCTCTGCCA
  GGTTATAAATATATTTATATAGCGATT
  CGATGTCTGCCACCTTAGTGTCTGTAG

Position weight matrix (PWM). ModE matrix-quality result    
A	0	0	3	1	5	0	5	1	5	0	3	3	2	2	1	1	7	0	5	0	5	1	0	1	3	4	4
C	6	0	2	0	0	1	1	2	0	5	1	1	2	3	2	0	0	4	1	2	0	2	5	0	2	1	1
G	1	7	0	0	2	0	1	0	1	1	1	0	3	1	0	0	0	1	0	1	0	3	0	6	0	0	1
T	0	0	2	6	0	6	0	4	1	1	2	3	0	1	4	6	0	2	1	4	2	1	2	0	2	2	1

Consensus    
;	consensus.strict             	CGatatataCaagcttAcatagCGaaa
;	consensus.strict.rc          	TTTCGCTATGTAAGCTTGTATATATCG
;	consensus.IUPAC              	CGmtrtayaCawscytAcayasCGmaa
;	consensus.IUPAC.rc           	TTKCGSTRTGTARGSWTGTRTAYAKCG
;	consensus.regexp             	CG[ac]t[ag]ta[ct]aCa[at][cg]c[ct]tAca[ct]a[cg]CG[ac]aa
;	consensus.regexp.rc          	TT[GT]CG[CG]T[AG]TGTA[AG]G[CG][AT]TGT[AG]TA[CT]A[GT]CG

PWM logo   


 


Evolutionary conservation of regulatory elements    
     Note: Evolutionary conservation of regulatory interactions and promoters is limited to gammaproteobacteria.
TF-target gene evolutionary conservation
Promoter-target gene evolutionary conservation


Evidence    

 [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS] Binding of purified proteins

 [EXP-IPI] Inferred from physical interaction

 [EXP-IEP-GENE-EXPRESSION-ANALYSIS] Gene expression analysis

 [COMP-HINF-SIMILAR-TO-CONSENSUS] A person inferred or reviewed a computer inference of sequence function based on similarity to a consensus sequence.

 [EXP-IMP-SITE-MUTATION] Site mutation


Reference(s)    

 [1] Grunden AM., Self WT., Villain M., Blalock JE., Shanmugam KT., 1999, An analysis of the binding of repressor protein ModE to modABCD (molybdate transport) operator/promoter DNA of Escherichia coli., J Biol Chem 274(34):24308-15

 [2] Tao H., Hasona A., Do PM., Ingram LO., Shanmugam KT., 2005, Global gene expression analysis revealed an unsuspected deo operon under the control of molybdate sensor, ModE protein, in Escherichia coli., Arch Microbiol 184(4):225-33

 [3] McNicholas PM., Chiang RC., Gunsalus RP., 1998, Anaerobic regulation of the Escherichia coli dmsABC operon requires the molybdate-responsive regulator ModE., Mol Microbiol 27(1):197-208

 [4] Self WT., Grunden AM., Hasona A., Shanmugam KT., 1999, Transcriptional regulation of molybdoenzyme synthesis in Escherichia coli in response to molybdenum: ModE-molybdate, a repressor of the modABCD (molybdate transport) operon is a secondary transcriptional activator for the hyc and nar operons., Microbiology 145 ( Pt 1):41-55

 [5] McNicholas PM., Rech SA., Gunsalus RP., 1997, Characterization of the ModE DNA-binding sites in the control regions of modABCD and moaABCDE of Escherichia coli., Mol Microbiol 23(3):515-24

 [6] McNicholas PM., Gunsalus RP., 2002, The molybdate-responsive Escherichia coli ModE transcriptional regulator coordinates periplasmic nitrate reductase (napFDAGHBC) operon expression with nitrate and molybdate availability., J Bacteriol 184(12):3253-9

 [7] Stewart V., Bledsoe PJ., Williams SB., 2003, Dual overlapping promoters control napF (periplasmic nitrate reductase) operon expression in Escherichia coli K-12., J Bacteriol 185(19):5862-70

 [8] Walkenhorst HM, Hemschemeier SK, Eichenlaub R, 1995, Molecular analysis of the molybdate uptake operon, modABCD, of Escherichia coli and modR, a regulatory gene., Microbiol Res, 150(4):347 10.1016/S0944-5013(11)80016-9

 [9] McNicholas PM, Chiang RC, Gunsalus RP, 1996, The Escherichia coli modE gene: effect of modE mutations on molybdate dependent modA expression., FEMS Microbiol Lett, 145(1):117 10.1016/0378-1097(96)00398-9

 [10] Grunden AM., Ray RM., Rosentel JK., Healy FG., Shanmugam KT., 1996, Repression of the Escherichia coli modABCD (molybdate transport) operon by ModE., J Bacteriol 178(3):735-44

 [11] Anderson LA, Palmer T, Price NC, Bornemann S, Boxer DH, Pau RN, 1997, Characterisation of the molybdenum-responsive ModE regulatory protein and its binding to the promoter region of the modABCD (molybdenum transport) operon of Escherichia coli., Eur J Biochem, 246(1):119 10.1111/j.1432-1033.1997.00119.x

 [12] Hasona A, Self WT, Ray RM, Shanmugam KT, 1998, Molybdate-dependent transcription of hyc and nar operons of Escherichia coli requires MoeA protein and ModE-molybdate., FEMS Microbiol Lett, 169(1):111 10.1111/j.1574-6968.1998.tb13306.x

 [13] Anderson LA., McNairn E., Lubke T., Pau RN., Boxer DH., Leubke T., 2000, ModE-dependent molybdate regulation of the molybdenum cofactor operon moa in Escherichia coli., J Bacteriol 182(24):7035-43

 [14] Kuper J, Meyer zu Berstenhorst S, Vödisch B, Mendel RR, Schwarz G, Boxer DH, 2003, In vivo detection of molybdate-binding proteins using a competition assay with ModE in Escherichia coli., FEMS Microbiol Lett, 218(1):187 10.1111/j.1574-6968.2003.tb11517.x

 [15] Studholme DJ., Pau RN., 2003, A DNA element recognised by the molybdenum-responsive transcription factor ModE is conserved in Proteobacteria, green sulphur bacteria and Archaea., BMC Microbiol 3:24

 [16] Hall DR, Gourley DG, Leonard GA, Duke EM, Anderson LA, Boxer DH, Hunter WN, 1999, The high-resolution crystal structure of the molybdate-dependent transcriptional regulator (ModE) from Escherichia coli: a novel combination of domain folds., EMBO J, 18(6):1435 10.1093/emboj/18.6.1435

 [17] Gourley DG, Schuttelkopf AW, Anderson LA, Price NC, Boxer DH, Hunter WN, 2001, Oxyanion binding alters conformation and quaternary structure of the c-terminal domain of the transcriptional regulator mode. Implications for molybdate-dependent regulation, signaling, storage, and transport., J Biol Chem, 276(23):20641 10.1074/jbc.M100919200

 [18] Schüttelkopf AW, Boxer DH, Hunter WN, 2003, Crystal structure of activated ModE reveals conformational changes involving both oxyanion and DNA-binding domains., J Mol Biol, 326(3):761 10.1016/s0022-2836(02)01358-x

 [19] Leimkühler S, 2020, The biosynthesis of the molybdenum cofactors in Escherichia coli., Environ Microbiol, 22(6):2007 10.1111/1462-2920.15003


RegulonDB