RegulonDB RegulonDB 11.2:Regulon Page
   

SoxR DNA-binding transcriptional dual regulator

Synonyms: SoxR-[2Fe-2S]3+ oxydized, SoxR-[2Fe-2S]2+ reduced, SoxR
Summary:
The SoxR protein, for "Superoxide Response protein," is negatively autoregulated and controls the transcription of the regulon involved in defense against redox-cycling drugs [5, 6, 7, 8] and in responses to nitric oxide [3, 9, 10, 11, 12, 13, 14, 15, 16, 17]. SoxR belongs to the MerR family and is a homodimer in solution [1, 18]. SoxR contains two essential [2Fe-2S] clusters for its transcriptional activity [19]. Each SoxR polypeptide contains a [2Fe-2S] cluster that senses the oxidants in the cell. Both Fe-SoxR and apo-SoxR bind to the promoter region, but only Fe-SoxR contributes to the activation in its oxidized form [1, 18, 20, 21, 22]. The redox state of the iron-sulfur cluster regulates SoxR activity [23, 24].
Read more >


Transcription factor      
TF conformation(s):
Name Conformation Type TF-Effector Interaction Type Apo/Holo Conformation Evidence Confidence level (C: Confirmed, S: Strong, W: Weak) References
SoxR Functional   nd nd nd
SoxR-[2Fe-2S]2+ reduced Non-Functional Covalent Apo [EXP-IDA], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS], [EXP-IPI] S [1]
SoxR-[2Fe-2S]3+ oxydized Functional Covalent Holo [EXP-IDA], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS], [EXP-IPI] S [1]
Evolutionary Family: MerR
TFBs length: 18
TFBs symmetry: inverted-repeat
Sensing class: Using internal synthesized signals
Connectivity class: Local Regulator
Gene name: soxR
  Genome position: 4277469-4277933
  Length: 465 bp / 154 aa
Operon name: soxR
TU(s) encoding the TF:
Transcription unit        Promoter
soxR
soxRp


Regulon       
Regulated gene(s) aroF, fumC, sodA, soxR, soxS, tyrA, yjcB, yrbL
Multifun term(s) of regulated gene(s) MultiFun Term (List of genes associated to the multifun term)
detoxification (3)
Transcription related (2)
activator (2)
repressor (2)
other (mechanical, nutritional, oxidative stress) (2)
Read more >
Regulated operon(s) aroF-tyrA, fumAC, sodA, soxR, soxS, yjcB, yrbL
First gene in the operon(s) aroF, fumC, sodA, soxR, soxS, yjcB, yrbL
Simple and complex regulons AcrR,FNR,Fur,SoxR
AcrR,FNR,Fur,SoxR,SoxS
ArcA,CRP,FNR,Fur,IHF,MarA,Rob,SoxR,SoxS
ArcA,CRP,FNR,Fur,MarA,SoxR,SoxS
BasR,PhoP,SoxR,SoxS
Read more >
Simple and complex regulatory phrases Regulatory phrase (List of promoters regulated by the phrase)
[SoxR,+](6)
[SoxR,-](1)


Transcription factor regulation    


Transcription factor binding sites (TFBSs) arrangements
      

  Functional conformation Function Promoter Sigma factor Central Rel-Pos Distance to first Gene Genes Sequence LeftPos RightPos Evidence Confidence level (C: Confirmed, S: Strong, W: Weak) References
  SoxR activator aroFp Sigma70 8.5 -43.5 aroF, tyrA
atcgttacgtCATCCTCGCTGAGGATCAactatcgcaa
 2741185 2741202 [EXP-IEP-RNA-SEQ], [COMP-HINF], [EXP-CHIP-EXO-MANUAL] S [2], [2]
  SoxR activator fumCp2 Sigma38 nd nd fumC
nd
 nd nd [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS] S [3], [3]
  SoxR activator sodAp Sigma70 9.0 -43.0 sodA
ataatgaaccAACTGCTTACGCGGCATTaacaatcggc
 4100758 4100775 [EXP-IEP-RNA-SEQ], [COMP-HINF], [EXP-CHIP-EXO-MANUAL] S [2], [2]
  SoxR repressor soxRp Sigma70 2.5 -20.5 soxR
gagtataattCCTCAAGTTAACTTGAGGtaaagcgatt
 4277440 4277457 [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [EXP-IEP-RNA-SEQ], [COMP-HINF], [EXP-CHIP-EXO-MANUAL], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS] C [1], [1], [2], [2], [4]
  SoxR activator soxSp Sigma70 -25.5 -65.5 soxS
aatcgctttaCCTCAAGTTAACTTGAGGaattatactc
 4277440 4277457 [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [EXP-IEP-RNA-SEQ], [COMP-HINF], [EXP-CHIP-EXO-MANUAL], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS] C [1], [1], [2], [2], [4]
  SoxR activator soxSp Sigma70 6.0 -35.0 soxS
tatactccccAACAGATGAATTAACGAActgaacactg
 4277409 4277426 [EXP-IEP-RNA-SEQ], [COMP-HINF], [EXP-CHIP-EXO-MANUAL] S [2], [2]
  SoxR activator yjcBp nd -4.0 -127.0 yjcB
gtgatatagtTCACAAAATTAATGAAACaaacagagtg
 4275159 4275176 [EXP-IEP-RNA-SEQ], [COMP-HINF], [EXP-CHIP-EXO-MANUAL] S [2], [2]
  SoxR activator yrbLp nd 36.0 5.0 yrbL
tttccaggagATGGCATGATTCGCTTATctgaacaaag
 3348447 3348464 [EXP-IEP-RNA-SEQ], [COMP-HINF], [EXP-CHIP-EXO-MANUAL] S [2], [2]


Alignment and PSSM for SoxR TFBSs    

Aligned TFBS of SoxR   
  Sequence
  TACCTCAAGTTAACTTGAGG
  TTCGTTAATTCATCTGTTGG
  TACGTCATCCTCGCTGAGGA
  AATGCCGCGTAAGCAGTTGG
  TTTGTTTCATTAATTTTGTG
  GATGGCATGATTCGCTTATC

Position weight matrix (PWM). SoxR matrix-quality result    
A	1	4	0	0	0	0	4	2	1	1	1	4	2	0	1	0	1	2	0	1
C	0	0	3	1	1	4	0	2	1	1	1	1	1	4	1	0	0	0	0	1
G	1	0	0	5	1	0	1	0	3	0	0	0	2	1	0	3	1	2	4	4
T	4	2	3	0	4	2	1	2	1	4	4	1	1	1	4	3	4	2	2	0

Consensus    
;	consensus.strict             	tacGtCacgttagCtgtgGG
;	consensus.strict.rc          	CCCACAGCTAACGTGACGTA
;	consensus.IUPAC              	twyGtYahgttarCtktdKG
;	consensus.IUPAC.rc           	CMHAMAGYTAACDTRACRWA
;	consensus.regexp             	t[at][ct]Gt[CT]a[act]gtta[ag]Ct[gt]t[agt][GT]G
;	consensus.regexp.rc          	C[AC][ACT]A[AC]AG[CT]TAAC[AGT]T[AG]AC[AG][AT]A

PWM logo   


 


Evolutionary conservation of regulatory elements    
     Note: Evolutionary conservation of regulatory interactions and promoters is limited to gammaproteobacteria.
Promoter-target gene evolutionary conservation


Evidence    

 [EXP-IDA] Inferred from direct assay

 [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS] Binding of purified proteins

 [EXP-IPI] Inferred from physical interaction

 [EXP-IEP-RNA-SEQ] high throughput RNA-seq evidence

 [COMP-HINF] Inferred by a human based on computational evidence

 [EXP-CHIP-EXO-MANUAL] ChIP-exo evidence used in manual assertion

 [EXP-IEP-GENE-EXPRESSION-ANALYSIS] Gene expression analysis


Reference(s)    

 [1] Hidalgo E., Bollinger JM., Bradley TM., Walsh CT., Demple B., 1995, Binuclear [2Fe-2S] clusters in the Escherichia coli SoxR protein and role of the metal centers in transcription., J Biol Chem 270(36):20908-14

 [2] Seo SW., Kim D., Szubin R., Palsson BO., 2015, Genome-wide Reconstruction of OxyR and SoxRS Transcriptional Regulatory Networks under Oxidative Stress in Escherichia coli K-12 MG1655., Cell Rep 12(8):1289-99

 [3] Fuentes AM., Diaz-Mejia JJ., Maldonado-Rodriguez R., Amabile-Cuevas CF., 2001, Differential activities of the SoxR protein of Escherichia coli: SoxS is not required for gene activation under iron deprivation., FEMS Microbiol Lett 201(2):271-5

 [4] Hidalgo E., Leautaud V., Demple B., 1998, The redox-regulated SoxR protein acts from a single DNA site as a repressor and an allosteric activator., EMBO J 17(9):2629-36

 [5] Greenberg JT, Monach P, Chou JH, Josephy PD, Demple B, 1990, Positive control of a global antioxidant defense regulon activated by superoxide-generating agents in Escherichia coli., Proc Natl Acad Sci U S A, 87(16):6181 10.1073/pnas.87.16.6181

 [6] Nunoshiba T., Hidalgo E., Amabile Cuevas CF., Demple B., 1992, Two-stage control of an oxidative stress regulon: the Escherichia coli SoxR protein triggers redox-inducible expression of the soxS regulatory gene., J Bacteriol 174(19):6054-60

 [7] Vasil'eva SV, Stupakova MV, Lobysheva II, Mikoyan VD, Vanin AF, 2001, Activation of the Escherichia coli SoxRS-regulon by nitric oxide and its physiological donors., Biochemistry (Mosc), 66(9):984 10.1023/a:1012317508971

 [8] Gu M, Imlay JA, 2011, The SoxRS response of Escherichia coli is directly activated by redox-cycling drugs rather than by superoxide., Mol Microbiol, 79(5):1136 10.1111/j.1365-2958.2010.07520.x

 [9] Tsaneva IR, Weiss B, 1990, soxR, a locus governing a superoxide response regulon in Escherichia coli K-12., J Bacteriol, 172(8):4197 10.1128/jb.172.8.4197-4205.1990

 [10] Lu C., Bentley WE., Rao G., 2003, Comparisons of oxidative stress response genes in aerobic Escherichia coli fermentations., Biotechnol Bioeng 83(7):864-70

 [11] Liochev SI, Fridovich I, 1992, Fumarase C, the stable fumarase of Escherichia coli, is controlled by the soxRS regulon., Proc Natl Acad Sci U S A, 89(13):5892 10.1073/pnas.89.13.5892

 [12] Liochev SI, Hausladen A, Fridovich I, 1999, Nitroreductase A is regulated as a member of the soxRS regulon of Escherichia coli., Proc Natl Acad Sci U S A, 96(7):3537 10.1073/pnas.96.7.3537

 [13] Demple B, 1999, Genetic responses against nitric oxide toxicity., Braz J Med Biol Res, 32(11):1417 10.1590/s0100-879x1999001100013

 [14] Demple B, Ding H, Jorgensen M, 2002, Escherichia coli SoxR protein: sensor/transducer of oxidative stress and nitric oxide., Methods Enzymol, 348(None):355 10.1016/s0076-6879(02)48654-5

 [15] Lo FC, Chen CL, Lee CM, Tsai MC, Lu TT, Liaw WF, Yu SS, 2008, A study of NO trafficking from dinitrosyl-iron complexes to the recombinant E. coli transcriptional factor SoxR., J Biol Inorg Chem, 13(6):961 10.1007/s00775-008-0383-6

 [16] Manchado M, Michán C, Pueyo C, 2000, Hydrogen peroxide activates the SoxRS regulon in vivo., J Bacteriol, 182(23):6842 10.1128/JB.182.23.6842-6844.2000

 [17] Agnez-Lima LF, Di Mascio P, Demple B, Menck CF, 2001, Singlet molecular oxygen triggers the soxRS regulon of Escherichia coli., Biol Chem, 382(7):1071 10.1515/BC.2001.134

 [18] Hidalgo E, Demple B, 1996, Activation of SoxR-dependent transcription in vitro by noncatalytic or NifS-mediated assembly of [2Fe-2S] clusters into apo-SoxR., J Biol Chem, 271(13):7269 10.1074/jbc.271.13.7269

 [19] Pomposiello PJ, Demple B, 2001, Redox-operated genetic switches: the SoxR and OxyR transcription factors., Trends Biotechnol, 19(3):109 10.1016/s0167-7799(00)01542-0

 [20] Ding H, Demple B, 1996, Glutathione-mediated destabilization in vitro of [2Fe-2S] centers in the SoxR regulatory protein., Proc Natl Acad Sci U S A, 93(18):9449 10.1073/pnas.93.18.9449

 [21] Gaudu P, Weiss B, 1996, SoxR, a [2Fe-2S] transcription factor, is active only in its oxidized form., Proc Natl Acad Sci U S A, 93(19):10094 10.1073/pnas.93.19.10094

 [22] Hidalgo E, Demple B, 1994, An iron-sulfur center essential for transcriptional activation by the redox-sensing SoxR protein., EMBO J, 13(1):138 10.1002/j.1460-2075.1994.tb06243.x

 [23] Hidalgo E, Ding H, Demple B, 1997, Redox signal transduction: mutations shifting [2Fe-2S] centers of the SoxR sensor-regulator to the oxidized form., Cell, 88(1):121 10.1016/s0092-8674(00)81864-4

 [24] Gaudu P, Moon N, Weiss B, 1997, Regulation of the soxRS oxidative stress regulon. Reversible oxidation of the Fe-S centers of SoxR in vivo., J Biol Chem, 272(8):5082 10.1074/jbc.272.8.5082

 [25] Lee KL, Singh AK, Heo L, Seok C, Roe JH, 2015, Factors affecting redox potential and differential sensitivity of SoxR to redox-active compounds., Mol Microbiol, 97(5):808 10.1111/mmi.13068

 [26] Gerstel A, Zamarreño Beas J, Duverger Y, Bouveret E, Barras F, Py B, 2020, Oxidative stress antagonizes fluoroquinolone drug sensitivity via the SoxR-SUF Fe-S cluster homeostatic axis., PLoS Genet, 16(11):e1009198 10.1371/journal.pgen.1009198

 [27] Dietrich LE, Teal TK, Price-Whelan A, Newman DK, 2008, Redox-active antibiotics control gene expression and community behavior in divergent bacteria., Science, 321(5893):1203 10.1126/science.1160619

 [28] Demple B, Amábile-Cuevas CF, 1991, Redox redux: the control of oxidative stress responses., Cell, 67(5):837 10.1016/0092-8674(91)90355-3

 [29] Liochev SI, Fridovich I, 2011, Is superoxide able to induce SoxRS?, Free Radic Biol Med, 50(12):1813 10.1016/j.freeradbiomed.2011.03.029

 [30] Lo FC, Lee JF, Liaw WF, Hsu IJ, Tsai YF, Chan SI, Yu SS, 2012, The metal core structures in the recombinant Escherichia coli transcriptional factor SoxR., Chemistry, 18(9):2565 10.1002/chem.201100838

 [31] Fujikawa M, Kobayashi K, Tsutsui Y, Tanaka T, Kozawa T, 2017, Rational Tuning of Superoxide Sensitivity in SoxR, the [2Fe-2S] Transcription Factor: Implications of Species-Specific Lysine Residues., Biochemistry, 56(2):403 10.1021/acs.biochem.6b01096

 [32] Wu J, Weiss B, 1992, Two-stage induction of the soxRS (superoxide response) regulon of Escherichia coli., J Bacteriol, 174(12):3915 10.1128/jb.174.12.3915-3920.1992

 [33] Amabile-Cuevas CF., Demple B., 1991, Molecular characterization of the soxRS genes of Escherichia coli: two genes control a superoxide stress regulon., Nucleic Acids Res 19(16):4479-84

 [34] Nunoshiba T., Hidalgo E., Li Z., Demple B., 1993, Negative autoregulation by the Escherichia coli SoxS protein: a dampening mechanism for the soxRS redox stress response., J Bacteriol 175(22):7492-4

 [35] Michán C, Manchado M, Pueyo C, 2002, SoxRS down-regulation of rob transcription., J Bacteriol, 184(17):4733 10.1128/JB.184.17.4733-4738.2002

 [36] Pomposiello PJ., Koutsolioutsou A., Carrasco D., Demple B., 2003, SoxRS-regulated expression and genetic analysis of the yggX gene of Escherichia coli., J Bacteriol 185(22):6624-32

 [37] Griffith KL, Shah IM, Wolf RE, 2004, Proteolytic degradation of Escherichia coli transcription activators SoxS and MarA as the mechanism for reversing the induction of the superoxide (SoxRS) and multiple antibiotic resistance (Mar) regulons., Mol Microbiol, 51(6):1801 10.1046/j.1365-2958.2003.03952.x

 [38] Giro M., Carrillo N., Krapp AR., 2006, Glucose-6-phosphate dehydrogenase and ferredoxin-NADP(H) reductase contribute to damage repair during the soxRS response of Escherichia coli., Microbiology 152(Pt 4):1119-28

 [39] Touati D, 2000, Sensing and protecting against superoxide stress in Escherichia coli--how many ways are there to trigger soxRS response?, Redox Rep, 5(5):287 10.1179/135100000101535825

 [40] Sakamoto A, Terui Y, Yoshida T, Yamamoto T, Suzuki H, Yamamoto K, Ishihama A, Igarashi K, Kashiwagi K, 2015, Three members of polyamine modulon under oxidative stress conditions: two transcription factors (SoxR and EmrR) and a glutathione synthetic enzyme (GshA)., PLoS One, 10(4):e0124883 10.1371/journal.pone.0124883

 [41] Thomas M, Benov L, 2018, The Contribution of Superoxide Radical to Cadmium Toxicity in E. coli., Biol Trace Elem Res, 181(2):361 10.1007/s12011-017-1048-5

 [42] Wang A, Crowley DE, 2005, Global gene expression responses to cadmium toxicity in Escherichia coli., J Bacteriol, 187(9):3259 10.1128/JB.187.9.3259-3266.2005

 [43] Watanabe S, Kita A, Kobayashi K, Miki K, 2008, Crystal structure of the [2Fe-2S] oxidative-stress sensor SoxR bound to DNA., Proc Natl Acad Sci U S A, 105(11):4121 10.1073/pnas.0709188105

 [44] Kobayashi K, 2017, Sensing Mechanisms in the Redox-Regulated, [2Fe-2S] Cluster-Containing, Bacterial Transcriptional Factor SoxR., Acc Chem Res, 50(7):1672 10.1021/acs.accounts.7b00137

 [45] Volkert MR, Landini P, 2001, Transcriptional responses to DNA damage., Curr Opin Microbiol, 4(2):178 10.1016/s1369-5274(00)00186-7

 [46] Spiro S, 2006, Nitric oxide-sensing mechanisms in Escherichia coli., Biochem Soc Trans, 34(Pt 1):200 10.1042/BST0340200

 [47] Lushchak VI, 2008, [Redox-sensors of microorganisms]., Ukr Biokhim Zh (1999), 80(4):25 None

 [48] Demple B, Hidalgo E, Ding H, 1999, Transcriptional regulation via redox-sensitive iron-sulphur centres in an oxidative stress response., Biochem Soc Symp, 64(None):119 None

 [49] Zheng M, Storz G, 2000, Redox sensing by prokaryotic transcription factors., Biochem Pharmacol, 59(1):1 10.1016/s0006-2952(99)00289-0

 [50] Kiley PJ, Beinert H, 2003, The role of Fe-S proteins in sensing and regulation in bacteria., Curr Opin Microbiol, 6(2):181 10.1016/s1369-5274(03)00039-0

 [51] Deng M, Zhu H, Guo J, 2010, [Structure, mechanism and roles of the transcription factor SoxR in bacteria--a review]., Wei Sheng Wu Xue Bao, 50(12):1575 None

 [52] Chiang SM, Schellhorn HE, 2012, Regulators of oxidative stress response genes in Escherichia coli and their functional conservation in bacteria., Arch Biochem Biophys, 525(2):161 10.1016/j.abb.2012.02.007

 [53] Kobayashi K, Fujikawa M, Kozawa T, 2014, Oxidative stress sensing by the iron-sulfur cluster in the transcription factor, SoxR., J Inorg Biochem, 133(None):87 10.1016/j.jinorgbio.2013.11.008


RegulonDB