|
|
| Synonyms: XylR, XylR-α-D-xylopyranose |
|
Summary:
"Xylose regulator," XylR, is a transcription factor involved in d-xylose degradation. It coregulates with CRP, a global transcriptional regulator [3] These regulators bind cooperatively to activate transcription of operons involved in transport and catabolism of D-xylose. Synthesis of these operons is induced when Escherichia coli is grown on D-xylose in the absence of glucose. Gene induction occurs when the physiological inducer, D-xylose, binds to XylR and when cellular cyclic AMP levels are high [3] XylR also has a regulatory role in the cellular resumption of growth during the metabolic switching from glucose to xylose [6]. When XylR is overexpressed the duration of the lag phase is reduced, and when it is titrated the duration of the lag phase is extended [6]. In the presence of d-xylose, XylR binds in tandem to four inverted repeat sequences in the xylAB/xylFGHR intergenic region to activate transcription by overlapping the -35 boxes of xylABp and xylFGHRp [3] The binding targets for XylR consist of 18-nucleotide-long directed repeat sequences that possess conserved motifs; each monomer binds to one of these conserved sequences [3, 4] XylR belongs to the AraC/XylS family [7, 8] Read more > |
| Transcription factor |  |
|||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| TF conformation(s): |
|
|||||||||||||||||||||
| Evolutionary Family: | AraC/XylS | |||||||||||||||||||||
| TFBs length: | 18 | |||||||||||||||||||||
| Sensing class: | External sensing using transported metabolites | |||||||||||||||||||||
| Connectivity class: | Local Regulator | |||||||||||||||||||||
| Gene name: | xylR | |||||||||||||||||||||
| Genome position: | 3734979-3736157 | |||||||||||||||||||||
| Length: | 1179 bp / 392 aa | |||||||||||||||||||||
| Operon name: | xylFGHR | |||||||||||||||||||||
| TU(s) encoding the TF: |
|
| Regulon |
|
||||||
|---|---|---|---|---|---|---|---|
| Regulated gene(s) | araC, xylA, xylB, xylE, xylF, xylG, xylH, xylR | ||||||
| Multifun term(s) of regulated gene(s) |
MultiFun Term (List of genes associated to the multifun term)
carbon compounds (8)
Transcription related (2)
activator (2)
operon (2)
membrane (2)
Read more >
|
||||||
| Regulated operon(s) | araC, xylAB, xylE, xylFGHR | ||||||
| First gene in the operon(s) | araC, xylA, xylE, xylF | ||||||
| Simple and complex regulons | AraC,CRP,XylR CRP,Fis,XylR CRP,XylR | ||||||
| Simple and complex regulatory phrases | Regulatory phrase (List of promoters regulated by the phrase) | ||||||
| Transcription factor regulation |
|
|---|
|
Transcription factor binding sites (TFBSs) arrangements
|
|---|
| Alignment and PSSM for XylR TFBSs | |
|---|
| Aligned TFBS of XylR |
|---|
| Sequence | |
|---|---|
| CAGTGTGAAATAACATAATTG | |
| CATTGTAAAAAATGATAATTG | |
| ATAAACCAAAAATCGTAATCG | |
| AAAGATAAAAATCTGTAATTG | |
| ACTTGTGAATTATCTCAATAG | |
| CATGACAAAAACGCGTAACAA | |
| AAGTGTCTATAATCACGGCAG | |
| AGAAAAGACATTACGTAAACG |
| Position weight matrix (PWM). XylR matrix-quality result |
|---|
A 5 5 3 2 4 1 3 7 7 6 5 5 2 0 3 0 7 7 1 3 1 C 3 1 0 0 0 2 2 0 1 0 0 1 1 6 0 2 0 0 2 2 0 G 0 1 2 2 4 0 3 0 0 0 0 0 1 1 4 0 1 1 0 0 7 T 0 1 3 4 0 5 0 1 0 2 3 2 4 1 1 6 0 0 5 3 0 |
| Consensus |
|---|
; consensus.strict aaatgtgAAaaatCgtAAtaG ; consensus.strict.rc CTATTACGATTTTTCACATTT ; consensus.IUPAC madkryvAAawatCryAAyhG ; consensus.IUPAC.rc CDRTTRYGATWTTTBRYMHTK ; consensus.regexp [ac]a[agt][gt][ag][ct][acg]AAa[at]atC[ag][ct]AA[ct][act]G ; consensus.regexp.rc C[AGT][AG]TT[AG][CT]GAT[AT]TTT[CGT][AG][CT][AC][ACT]T[GT] |
| PWM logo |
|---|
|
|
| Evolutionary conservation of regulatory elements | |
|---|
| TF-target gene evolutionary conservation |
|
| Promoter-target gene evolutionary conservation |
|
| Reference(s) |
|
|---|---|
[EXP-IDA-BINDING-OF-PURIFIED-PROTEINS] Binding of purified proteins